Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506756530:

Variant ID: vg0506756530 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6756530
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.33, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TCTGAAGACTAAATTTCAGAAAACTATAATTTTAGCGATAAAACTATCAGTTTGTTGTGACATTAGTGATAAATTTCAGTTTGCTATAATAATAGTGTGG[A/G]
AAATTATCACAAAACTCAGCTAAAACTCAGCTATTGTTGCAGCAAACTGAAACTTGTCGCTAATGTCGCAGCAAACTGATAGTTTTATCACTAAAGTTAT

Reverse complement sequence

ATAACTTTAGTGATAAAACTATCAGTTTGCTGCGACATTAGCGACAAGTTTCAGTTTGCTGCAACAATAGCTGAGTTTTAGCTGAGTTTTGTGATAATTT[T/C]
CCACACTATTATTATAGCAAACTGAAATTTATCACTAATGTCACAACAAACTGATAGTTTTATCGCTAAAATTATAGTTTTCTGAAATTTAGTCTTCAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.50%	0.11%	0.00%	NA
All Indica	2759	87.90%	12.00%	0.04%	0.00%	NA
All Japonica	1512	4.80%	95.20%	0.00%	0.00%	NA
Aus	269	81.00%	17.80%	1.12%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	77.00%	23.00%	0.00%	0.00%	NA
Indica III	913	85.50%	14.50%	0.00%	0.00%	NA
Indica Intermediate	786	89.30%	10.60%	0.13%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	5.20%	94.80%	0.00%	0.00%	NA
Japonica Intermediate	241	14.10%	85.90%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	43.30%	55.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506756530	A -> G	LOC_Os05g11850.1	upstream_gene_variant ; 136.0bp to feature; MODIFIER	silent_mutation	Average:88.075; most accessible tissue: Callus, score: 94.893	N	N	N	N
vg0506756530	A -> G	LOC_Os05g11840.1	downstream_gene_variant ; 4417.0bp to feature; MODIFIER	silent_mutation	Average:88.075; most accessible tissue: Callus, score: 94.893	N	N	N	N
vg0506756530	A -> G	LOC_Os05g11860.1	downstream_gene_variant ; 4189.0bp to feature; MODIFIER	silent_mutation	Average:88.075; most accessible tissue: Callus, score: 94.893	N	N	N	N
vg0506756530	A -> G	LOC_Os05g11850-LOC_Os05g11860	intergenic_region ; MODIFIER	silent_mutation	Average:88.075; most accessible tissue: Callus, score: 94.893	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506756530	NA	1.47E-29	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530	NA	1.54E-09	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530	NA	5.08E-34	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530	1.65E-06	3.31E-44	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530	NA	2.57E-31	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530	1.92E-07	2.79E-44	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530	NA	6.26E-07	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530	NA	3.56E-13	mr1722_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530	NA	2.67E-36	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251