| Variant ID: vg0506756530 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6756530 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.33, others allele: 0.00, population size: 99. )
TCTGAAGACTAAATTTCAGAAAACTATAATTTTAGCGATAAAACTATCAGTTTGTTGTGACATTAGTGATAAATTTCAGTTTGCTATAATAATAGTGTGG[A/G]
AAATTATCACAAAACTCAGCTAAAACTCAGCTATTGTTGCAGCAAACTGAAACTTGTCGCTAATGTCGCAGCAAACTGATAGTTTTATCACTAAAGTTAT
ATAACTTTAGTGATAAAACTATCAGTTTGCTGCGACATTAGCGACAAGTTTCAGTTTGCTGCAACAATAGCTGAGTTTTAGCTGAGTTTTGTGATAATTT[T/C]
CCACACTATTATTATAGCAAACTGAAATTTATCACTAATGTCACAACAAACTGATAGTTTTATCGCTAAAATTATAGTTTTCTGAAATTTAGTCTTCAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.40% | 41.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 87.90% | 12.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 81.00% | 17.80% | 1.12% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.00% | 23.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.30% | 10.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.10% | 85.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 55.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506756530 | A -> G | LOC_Os05g11850.1 | upstream_gene_variant ; 136.0bp to feature; MODIFIER | silent_mutation | Average:88.075; most accessible tissue: Callus, score: 94.893 | N | N | N | N |
| vg0506756530 | A -> G | LOC_Os05g11840.1 | downstream_gene_variant ; 4417.0bp to feature; MODIFIER | silent_mutation | Average:88.075; most accessible tissue: Callus, score: 94.893 | N | N | N | N |
| vg0506756530 | A -> G | LOC_Os05g11860.1 | downstream_gene_variant ; 4189.0bp to feature; MODIFIER | silent_mutation | Average:88.075; most accessible tissue: Callus, score: 94.893 | N | N | N | N |
| vg0506756530 | A -> G | LOC_Os05g11850-LOC_Os05g11860 | intergenic_region ; MODIFIER | silent_mutation | Average:88.075; most accessible tissue: Callus, score: 94.893 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506756530 | NA | 1.47E-29 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506756530 | NA | 1.54E-09 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506756530 | NA | 5.08E-34 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506756530 | 1.65E-06 | 3.31E-44 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506756530 | NA | 2.57E-31 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506756530 | 1.92E-07 | 2.79E-44 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506756530 | NA | 6.26E-07 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506756530 | NA | 3.56E-13 | mr1722_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506756530 | NA | 2.67E-36 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |