\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506756530:

Variant ID: vg0506756530 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6756530
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.33, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGAAGACTAAATTTCAGAAAACTATAATTTTAGCGATAAAACTATCAGTTTGTTGTGACATTAGTGATAAATTTCAGTTTGCTATAATAATAGTGTGG[A/G]
AAATTATCACAAAACTCAGCTAAAACTCAGCTATTGTTGCAGCAAACTGAAACTTGTCGCTAATGTCGCAGCAAACTGATAGTTTTATCACTAAAGTTAT

Reverse complement sequence

ATAACTTTAGTGATAAAACTATCAGTTTGCTGCGACATTAGCGACAAGTTTCAGTTTGCTGCAACAATAGCTGAGTTTTAGCTGAGTTTTGTGATAATTT[T/C]
CCACACTATTATTATAGCAAACTGAAATTTATCACTAATGTCACAACAAACTGATAGTTTTATCGCTAAAATTATAGTTTTCTGAAATTTAGTCTTCAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 41.50% 0.11% 0.00% NA
All Indica  2759 87.90% 12.00% 0.04% 0.00% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 81.00% 17.80% 1.12% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 77.00% 23.00% 0.00% 0.00% NA
Indica III  913 85.50% 14.50% 0.00% 0.00% NA
Indica Intermediate  786 89.30% 10.60% 0.13% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 14.10% 85.90% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506756530 A -> G LOC_Os05g11850.1 upstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:88.075; most accessible tissue: Callus, score: 94.893 N N N N
vg0506756530 A -> G LOC_Os05g11840.1 downstream_gene_variant ; 4417.0bp to feature; MODIFIER silent_mutation Average:88.075; most accessible tissue: Callus, score: 94.893 N N N N
vg0506756530 A -> G LOC_Os05g11860.1 downstream_gene_variant ; 4189.0bp to feature; MODIFIER silent_mutation Average:88.075; most accessible tissue: Callus, score: 94.893 N N N N
vg0506756530 A -> G LOC_Os05g11850-LOC_Os05g11860 intergenic_region ; MODIFIER silent_mutation Average:88.075; most accessible tissue: Callus, score: 94.893 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506756530 NA 1.47E-29 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530 NA 1.54E-09 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530 NA 5.08E-34 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530 1.65E-06 3.31E-44 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530 NA 2.57E-31 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530 1.92E-07 2.79E-44 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530 NA 6.26E-07 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530 NA 3.56E-13 mr1722_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506756530 NA 2.67E-36 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251