\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506748703:

Variant ID: vg0506748703 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6748703
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTTGTCTTAAATACTCCCTCCGTTTCACAATATAAGACTTTCTAGCATTACCTATATTCATATAGATGCTAATGAATCTAGACATTATTATATATATA[G/T]
ATTCATTAGCATCTATATGAATGTGGACAATGCTAAAAAGTTTTACATTGTGAAACAGAGGAAATAATTACTATATTTTCATCCATCATCTATTGAAAAT

Reverse complement sequence

ATTTTCAATAGATGATGGATGAAAATATAGTAATTATTTCCTCTGTTTCACAATGTAAAACTTTTTAGCATTGTCCACATTCATATAGATGCTAATGAAT[C/A]
TATATATATAATAATGTCTAGATTCATTAGCATCTATATGAATATAGGTAATGCTAGAAAGTCTTATATTGTGAAACGGAGGGAGTATTTAAGACAAAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 49.80% 0.06% 0.00% NA
All Indica  2759 76.30% 23.70% 0.04% 0.00% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 82.20% 17.80% 0.00% 0.00% NA
Indica I  595 79.70% 20.30% 0.00% 0.00% NA
Indica II  465 74.20% 25.80% 0.00% 0.00% NA
Indica III  913 74.90% 25.10% 0.00% 0.00% NA
Indica Intermediate  786 76.60% 23.30% 0.13% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 25.60% 72.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506748703 G -> T LOC_Os05g11840.1 upstream_gene_variant ; 2095.0bp to feature; MODIFIER silent_mutation Average:56.824; most accessible tissue: Callus, score: 98.84 N N N N
vg0506748703 G -> T LOC_Os05g11850.1 downstream_gene_variant ; 3519.0bp to feature; MODIFIER silent_mutation Average:56.824; most accessible tissue: Callus, score: 98.84 N N N N
vg0506748703 G -> T LOC_Os05g11820-LOC_Os05g11840 intergenic_region ; MODIFIER silent_mutation Average:56.824; most accessible tissue: Callus, score: 98.84 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506748703 NA 7.42E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506748703 5.61E-06 2.82E-08 mr1677 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506748703 NA 1.68E-07 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506748703 NA 3.21E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506748703 NA 1.82E-32 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251