\
| Variant ID: vg0506748703 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6748703 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTTTGTCTTAAATACTCCCTCCGTTTCACAATATAAGACTTTCTAGCATTACCTATATTCATATAGATGCTAATGAATCTAGACATTATTATATATATA[G/T]
ATTCATTAGCATCTATATGAATGTGGACAATGCTAAAAAGTTTTACATTGTGAAACAGAGGAAATAATTACTATATTTTCATCCATCATCTATTGAAAAT
ATTTTCAATAGATGATGGATGAAAATATAGTAATTATTTCCTCTGTTTCACAATGTAAAACTTTTTAGCATTGTCCACATTCATATAGATGCTAATGAAT[C/A]
TATATATATAATAATGTCTAGATTCATTAGCATCTATATGAATATAGGTAATGCTAGAAAGTCTTATATTGTGAAACGGAGGGAGTATTTAAGACAAAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 49.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 76.30% | 23.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.20% | 25.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.90% | 25.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.60% | 23.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 25.60% | 72.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506748703 | G -> T | LOC_Os05g11840.1 | upstream_gene_variant ; 2095.0bp to feature; MODIFIER | silent_mutation | Average:56.824; most accessible tissue: Callus, score: 98.84 | N | N | N | N |
| vg0506748703 | G -> T | LOC_Os05g11850.1 | downstream_gene_variant ; 3519.0bp to feature; MODIFIER | silent_mutation | Average:56.824; most accessible tissue: Callus, score: 98.84 | N | N | N | N |
| vg0506748703 | G -> T | LOC_Os05g11820-LOC_Os05g11840 | intergenic_region ; MODIFIER | silent_mutation | Average:56.824; most accessible tissue: Callus, score: 98.84 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506748703 | NA | 7.42E-06 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506748703 | 5.61E-06 | 2.82E-08 | mr1677 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506748703 | NA | 1.68E-07 | mr1678 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506748703 | NA | 3.21E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506748703 | NA | 1.82E-32 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |