\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506747780:

Variant ID: vg0506747780 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6747780
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.29, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAGGGCGTCAGTTTCGGTCTTCCAACACCTCTATGTGCTTTTCTCGCCATATGAGGCTTGCTCATTCACGTCTTACTCTTTCATTCGCGGATAGTGGG[G/A]
AACCGATCTGGTAGTGTCTCTCATCTTGTCTCACAGCAACAGTGGACGTGTTCGTCCGACGGCTAGCGTGTTCATCCGATGCATGCTAGGTGTTTCCCGC

Reverse complement sequence

GCGGGAAACACCTAGCATGCATCGGATGAACACGCTAGCCGTCGGACGAACACGTCCACTGTTGCTGTGAGACAAGATGAGAGACACTACCAGATCGGTT[C/T]
CCCACTATCCGCGAATGAAAGAGTAAGACGTGAATGAGCAAGCCTCATATGGCGAGAAAAGCACATAGAGGTGTTGGAAGACCGAAACTGACGCCCTCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 49.20% 0.99% 0.32% NA
All Indica  2759 75.20% 23.20% 1.05% 0.54% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 76.60% 18.20% 5.20% 0.00% NA
Indica I  595 78.20% 20.20% 0.84% 0.84% NA
Indica II  465 73.80% 25.40% 0.43% 0.43% NA
Indica III  913 74.20% 24.80% 0.66% 0.44% NA
Indica Intermediate  786 74.90% 22.50% 2.04% 0.51% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 22.20% 73.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506747780 G -> DEL N N silent_mutation Average:55.103; most accessible tissue: Callus, score: 79.2 N N N N
vg0506747780 G -> A LOC_Os05g11840.1 upstream_gene_variant ; 3018.0bp to feature; MODIFIER silent_mutation Average:55.103; most accessible tissue: Callus, score: 79.2 N N N N
vg0506747780 G -> A LOC_Os05g11850.1 downstream_gene_variant ; 4442.0bp to feature; MODIFIER silent_mutation Average:55.103; most accessible tissue: Callus, score: 79.2 N N N N
vg0506747780 G -> A LOC_Os05g11820-LOC_Os05g11840 intergenic_region ; MODIFIER silent_mutation Average:55.103; most accessible tissue: Callus, score: 79.2 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506747780 6.66E-06 2.30E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780 2.58E-06 1.08E-06 mr1269 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780 NA 5.93E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780 3.84E-06 3.69E-08 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780 4.76E-06 NA mr1678 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780 4.40E-06 3.57E-08 mr1678 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780 NA 2.58E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506747780 NA 6.95E-32 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251