Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506744833:

Variant ID: vg0506744833 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6744833
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGTGTAGCCAACTACTAGCTTTAATTCATCTATAACTAATTTAATAGCTTATTCATATAATAGTTAGTTATAAATATATACTACACTATTAATATATA[G/C]
TTCTATATTTCATACACACACAATGTATTGAAGTCTGTGCTGCAGCTGGTTATAAATTTGTAGCGTGTTTGTTTTCTCACTCTTCTCTTCTCTTCTCCAC

Reverse complement sequence

GTGGAGAAGAGAAGAGAAGAGTGAGAAAACAAACACGCTACAAATTTATAACCAGCTGCAGCACAGACTTCAATACATTGTGTGTGTATGAAATATAGAA[C/G]
TATATATTAATAGTGTAGTATATATTTATAACTAACTATTATATGAATAAGCTATTAAATTAGTTATAGATGAATTAAAGCTAGTAGTTGGCTACACTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 49.70% 0.19% 0.00% NA
All Indica  2759 76.30% 23.50% 0.18% 0.00% NA
All Japonica  1512 1.30% 98.50% 0.20% 0.00% NA
Aus  269 81.80% 18.20% 0.00% 0.00% NA
Indica I  595 79.80% 20.20% 0.00% 0.00% NA
Indica II  465 74.40% 25.60% 0.00% 0.00% NA
Indica III  913 74.00% 25.60% 0.33% 0.00% NA
Indica Intermediate  786 77.40% 22.40% 0.25% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.60% 0.40% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.41% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 25.60% 73.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506744833 G -> C LOC_Os05g11820-LOC_Os05g11840 intergenic_region ; MODIFIER silent_mutation Average:90.742; most accessible tissue: Zhenshan97 panicle, score: 97.445 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0506744833 G C 0.0 0.01 0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506744833 NA 3.83E-28 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506744833 2.59E-06 1.01E-07 mr1677 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506744833 3.29E-06 NA mr1678 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506744833 2.56E-06 6.09E-08 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506744833 NA 1.64E-33 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251