\
| Variant ID: vg0506708732 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6708732 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 113. )
TTTTTTTATTGTGACGGTTCAGAAGTCTACACATTTTGGTTTTTGAAGAATTACCTCCTAAAATATTACCATCATTTGAATTACCCCATGAAATTTTAAT[A/G]
CCAGATGCAACTGTTCAAACCGGCAAATAACACACTAACTCAATCTGAAACAGTTTTAGTCCTACGTGACAATCCAGTTAGTATTTTTTTATAAAAAAAA
TTTTTTTTATAAAAAAATACTAACTGGATTGTCACGTAGGACTAAAACTGTTTCAGATTGAGTTAGTGTGTTATTTGCCGGTTTGAACAGTTGCATCTGG[T/C]
ATTAAAATTTCATGGGGTAATTCAAATGATGGTAATATTTTAGGAGGTAATTCTTCAAAAACCAAAATGTGTAGACTTCTGAACCGTCACAATAAAAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 21.10% | 0.21% | 4.06% | NA |
| All Indica | 2759 | 65.40% | 33.20% | 0.29% | 1.16% | NA |
| All Japonica | 1512 | 99.40% | 0.50% | 0.00% | 0.13% | NA |
| Aus | 269 | 17.80% | 24.90% | 0.37% | 56.88% | NA |
| Indica I | 595 | 90.40% | 9.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 60.00% | 38.10% | 0.43% | 1.51% | NA |
| Indica III | 913 | 44.90% | 54.20% | 0.33% | 0.55% | NA |
| Indica Intermediate | 786 | 73.40% | 23.70% | 0.38% | 2.54% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 85.60% | 8.90% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506708732 | A -> DEL | N | N | silent_mutation | Average:60.25; most accessible tissue: Callus, score: 96.524 | N | N | N | N |
| vg0506708732 | A -> G | LOC_Os05g11790-LOC_Os05g11810 | intergenic_region ; MODIFIER | silent_mutation | Average:60.25; most accessible tissue: Callus, score: 96.524 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506708732 | 8.26E-10 | 2.83E-28 | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | 2.91E-07 | 9.57E-15 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | NA | 4.27E-08 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | NA | 3.77E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | NA | 3.58E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | NA | 1.01E-06 | mr1595 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | NA | 3.48E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | 1.90E-07 | NA | mr1632 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | 3.92E-06 | 7.50E-10 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | NA | 4.57E-06 | mr1888 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | 5.26E-14 | 2.99E-31 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | 4.14E-10 | 3.22E-19 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | NA | 3.20E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | NA | 2.76E-06 | mr1159_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | 6.43E-11 | 1.13E-31 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506708732 | 6.68E-08 | 8.32E-16 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |