\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506708732:

Variant ID: vg0506708732 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6708732
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTATTGTGACGGTTCAGAAGTCTACACATTTTGGTTTTTGAAGAATTACCTCCTAAAATATTACCATCATTTGAATTACCCCATGAAATTTTAAT[A/G]
CCAGATGCAACTGTTCAAACCGGCAAATAACACACTAACTCAATCTGAAACAGTTTTAGTCCTACGTGACAATCCAGTTAGTATTTTTTTATAAAAAAAA

Reverse complement sequence

TTTTTTTTATAAAAAAATACTAACTGGATTGTCACGTAGGACTAAAACTGTTTCAGATTGAGTTAGTGTGTTATTTGCCGGTTTGAACAGTTGCATCTGG[T/C]
ATTAAAATTTCATGGGGTAATTCAAATGATGGTAATATTTTAGGAGGTAATTCTTCAAAAACCAAAATGTGTAGACTTCTGAACCGTCACAATAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 21.10% 0.21% 4.06% NA
All Indica  2759 65.40% 33.20% 0.29% 1.16% NA
All Japonica  1512 99.40% 0.50% 0.00% 0.13% NA
Aus  269 17.80% 24.90% 0.37% 56.88% NA
Indica I  595 90.40% 9.60% 0.00% 0.00% NA
Indica II  465 60.00% 38.10% 0.43% 1.51% NA
Indica III  913 44.90% 54.20% 0.33% 0.55% NA
Indica Intermediate  786 73.40% 23.70% 0.38% 2.54% NA
Temperate Japonica  767 99.60% 0.30% 0.00% 0.13% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 85.60% 8.90% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506708732 A -> DEL N N silent_mutation Average:60.25; most accessible tissue: Callus, score: 96.524 N N N N
vg0506708732 A -> G LOC_Os05g11790-LOC_Os05g11810 intergenic_region ; MODIFIER silent_mutation Average:60.25; most accessible tissue: Callus, score: 96.524 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506708732 8.26E-10 2.83E-28 mr1039 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 2.91E-07 9.57E-15 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 NA 4.27E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 NA 3.77E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 NA 3.58E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 NA 1.01E-06 mr1595 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 NA 3.48E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 1.90E-07 NA mr1632 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 3.92E-06 7.50E-10 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 NA 4.57E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 5.26E-14 2.99E-31 mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 4.14E-10 3.22E-19 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 NA 3.20E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 NA 2.76E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 6.43E-11 1.13E-31 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506708732 6.68E-08 8.32E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251