\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506677994:

Variant ID: vg0506677994 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6677994
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCAATTTTATAATTACCCCTATTTTTAAATTGGGCCGAGTTTAGTTTCAAACTTTTTCTTTAAACTTTCAATTTTTCCATCACATCAAAACTTTCCTA[C/T]
ACACATAAACTTTCAACTTTTCTATCACAACGTTCCAATTTAAACTTCTAATTTTGGTGTAACACACCCTTGGTGAAATAAATAAACCTACGACAATAAT

Reverse complement sequence

ATTATTGTCGTAGGTTTATTTATTTCACCAAGGGTGTGTTACACCAAAATTAGAAGTTTAAATTGGAACGTTGTGATAGAAAAGTTGAAAGTTTATGTGT[G/A]
TAGGAAAGTTTTGATGTGATGGAAAAATTGAAAGTTTAAAGAAAAAGTTTGAAACTAAACTCGGCCCAATTTAAAAATAGGGGTAATTATAAAATTGAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 0.10% 11.89% 23.93% NA
All Indica  2759 61.40% 0.20% 9.13% 29.32% NA
All Japonica  1512 64.40% 0.00% 19.78% 15.81% NA
Aus  269 76.60% 0.00% 0.00% 23.42% NA
Indica I  595 89.20% 0.00% 1.18% 9.58% NA
Indica II  465 58.50% 0.00% 7.74% 33.76% NA
Indica III  913 37.60% 0.30% 16.10% 46.00% NA
Indica Intermediate  786 69.60% 0.30% 7.89% 22.26% NA
Temperate Japonica  767 94.40% 0.00% 3.13% 2.48% NA
Tropical Japonica  504 23.60% 0.00% 40.67% 35.71% NA
Japonica Intermediate  241 54.40% 0.00% 29.05% 16.60% NA
VI/Aromatic  96 92.70% 0.00% 2.08% 5.21% NA
Intermediate  90 73.30% 0.00% 10.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506677994 C -> T LOC_Os05g11760.1 upstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:81.759; most accessible tissue: Callus, score: 93.56 N N N N
vg0506677994 C -> T LOC_Os05g11770.1 upstream_gene_variant ; 214.0bp to feature; MODIFIER silent_mutation Average:81.759; most accessible tissue: Callus, score: 93.56 N N N N
vg0506677994 C -> T LOC_Os05g11760-LOC_Os05g11770 intergenic_region ; MODIFIER silent_mutation Average:81.759; most accessible tissue: Callus, score: 93.56 N N N N
vg0506677994 C -> DEL N N silent_mutation Average:81.759; most accessible tissue: Callus, score: 93.56 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506677994 2.69E-06 NA mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 4.91E-12 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 2.61E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 2.25E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 7.98E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 6.83E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 8.24E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 2.31E-07 mr1595 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 1.91E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 3.20E-08 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 5.65E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 3.01E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 5.55E-09 NA mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 5.16E-09 1.20E-15 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 5.24E-06 mr1124_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 5.39E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 1.43E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 8.20E-08 NA mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 8.56E-09 1.28E-14 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506677994 NA 4.19E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251