\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506635057:

Variant ID: vg0506635057 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6635057
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.04, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GGTACACCGATCTTTAATCCCGGTTAATAACACCAACCGGAACTAAAGATTGATCAGCCGGCCACGTGGCTGACCGATCTTTAGTCCCGGTTATTTCACT[T/C]
GGGACTAAAGATCGCTATCTTTAGTCCCGGATTCGTAGTCCCGGTTGGACAACCGGGACTAAAGGGGGGTTACGAACCGGGACTACAAACGGTTTGTCCA

Reverse complement sequence

TGGACAAACCGTTTGTAGTCCCGGTTCGTAACCCCCCTTTAGTCCCGGTTGTCCAACCGGGACTACGAATCCGGGACTAAAGATAGCGATCTTTAGTCCC[A/G]
AGTGAAATAACCGGGACTAAAGATCGGTCAGCCACGTGGCCGGCTGATCAATCTTTAGTTCCGGTTGGTGTTATTAACCGGGATTAAAGATCGGTGTACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 21.70% 19.55% 2.79% NA
All Indica  2759 55.70% 35.60% 8.16% 0.54% NA
All Japonica  1512 61.00% 1.30% 30.56% 7.08% NA
Aus  269 15.60% 3.00% 80.30% 1.12% NA
Indica I  595 86.40% 10.40% 3.03% 0.17% NA
Indica II  465 54.40% 40.60% 4.09% 0.86% NA
Indica III  913 35.40% 56.70% 7.56% 0.33% NA
Indica Intermediate  786 56.70% 27.20% 15.14% 0.89% NA
Temperate Japonica  767 88.70% 0.80% 9.39% 1.17% NA
Tropical Japonica  504 22.40% 2.00% 60.12% 15.48% NA
Japonica Intermediate  241 53.90% 1.70% 36.10% 8.30% NA
VI/Aromatic  96 91.70% 0.00% 3.12% 5.21% NA
Intermediate  90 62.20% 15.60% 20.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506635057 T -> DEL N N silent_mutation Average:40.334; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0506635057 T -> C LOC_Os05g11680-LOC_Os05g11700 intergenic_region ; MODIFIER silent_mutation Average:40.334; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506635057 NA 6.39E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 2.02E-07 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 4.23E-06 NA mr1072 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 3.23E-06 NA mr1075 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 6.68E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 8.09E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 3.57E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 1.75E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 8.47E-07 mr1595 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 5.29E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 1.84E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 3.11E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 2.41E-06 NA mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 8.57E-08 1.72E-14 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 1.69E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 7.43E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 3.23E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 5.55E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 5.06E-06 8.89E-13 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 5.21E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 2.46E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506635057 NA 2.76E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251