\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506633819:

Variant ID: vg0506633819 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6633819
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTACTGCCGTACAACACAGAGTGAGTTCTTATTGTCGTTCGGACAAATTTCATTCCCATCCATATAACATGTACATTCTGATATTTATCTCATCTCA[C/A,T]
GCATATTCCAGATTCCACTGGGTCCTATTATTTTTCGACTTGGACGCATGCAGAGTCACTGTGTACGACTCAATGAATAAAGAGGAGAAGGTTTTTGACA

Reverse complement sequence

TGTCAAAAACCTTCTCCTCTTTATTCATTGAGTCGTACACAGTGACTCTGCATGCGTCCAAGTCGAAAAATAATAGGACCCAGTGGAATCTGGAATATGC[G/T,A]
TGAGATGAGATAAATATCAGAATGTACATGTTATATGGATGGGAATGAAATTTGTCCGAACGACAATAAGAACTCACTCTGTGTTGTACGGCAGTAGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 2.70% 8.02% 5.10% A: 0.11%
All Indica  2759 79.80% 0.90% 10.62% 8.59% A: 0.14%
All Japonica  1512 98.40% 0.50% 0.93% 0.20% NA
Aus  269 40.10% 34.60% 24.54% 0.37% A: 0.37%
Indica I  595 87.10% 0.00% 10.92% 2.02% NA
Indica II  465 84.10% 1.70% 8.39% 5.81% NA
Indica III  913 72.80% 0.50% 11.61% 14.79% A: 0.22%
Indica Intermediate  786 79.80% 1.40% 10.56% 8.02% A: 0.25%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.60% 0.80% 1.98% 0.60% NA
Japonica Intermediate  241 97.10% 1.20% 1.66% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 92.20% 2.20% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506633819 C -> T LOC_Os05g11680-LOC_Os05g11700 intergenic_region ; MODIFIER silent_mutation Average:28.798; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N
vg0506633819 C -> DEL N N silent_mutation Average:28.798; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N
vg0506633819 C -> A LOC_Os05g11680-LOC_Os05g11700 intergenic_region ; MODIFIER silent_mutation Average:28.798; most accessible tissue: Minghui63 flag leaf, score: 49.097 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506633819 NA 4.83E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 2.09E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 3.22E-15 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 8.35E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 1.03E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 9.56E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 2.55E-09 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 1.22E-08 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 3.98E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 2.09E-06 NA mr1414 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 3.59E-10 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 5.11E-10 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 1.49E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 2.76E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 6.28E-09 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506633819 NA 1.85E-09 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251