\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506632469:

Variant ID: vg0506632469 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6632469
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TAACCTCTCATCACGTGAAGGTGGCGTTTGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTATAGGCCGATTCCAACAAGATACTCTAGGGT[C/T]
GAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATAC

Reverse complement sequence

GTATAATGGCGTGGCTTGTGTCTCGTAGATGCGTCTCACCGTCTCCTCCTGGGTAGTCCAACTCGAGGTCCTCGTACGCGGCTTCCACCAGCTCAACTTC[G/A]
ACCCTAGAGTATCTTGTTGGAATCGGCCTATAGTGGTAAGTCCCGGAAGGGTCCGTTGGGATGGCCATTCCAAACGCCACCTTCACGTGATGAGAGGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 34.10% 0.17% 0.17% NA
All Indica  2759 61.30% 38.30% 0.14% 0.25% NA
All Japonica  1512 65.10% 34.70% 0.20% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 89.10% 10.80% 0.17% 0.00% NA
Indica II  465 57.20% 42.60% 0.22% 0.00% NA
Indica III  913 38.30% 61.00% 0.11% 0.55% NA
Indica Intermediate  786 69.50% 30.20% 0.13% 0.25% NA
Temperate Japonica  767 94.00% 5.70% 0.26% 0.00% NA
Tropical Japonica  504 24.60% 75.20% 0.20% 0.00% NA
Japonica Intermediate  241 58.10% 41.90% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 68.90% 28.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506632469 C -> T LOC_Os05g11680-LOC_Os05g11700 intergenic_region ; MODIFIER silent_mutation Average:60.132; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N
vg0506632469 C -> DEL N N silent_mutation Average:60.132; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506632469 7.82E-06 NA mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 1.40E-12 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 1.08E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 8.09E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 7.78E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 9.72E-06 mr1595 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 2.09E-08 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 5.32E-11 NA mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 2.11E-11 6.60E-17 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 4.37E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 4.23E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 1.74E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 7.21E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 1.43E-08 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 1.17E-06 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 1.05E-07 1.12E-14 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506632469 NA 7.89E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251