\
| Variant ID: vg0506632469 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6632469 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 263. )
TAACCTCTCATCACGTGAAGGTGGCGTTTGGAATGGCCATCCCAACGGACCCTTCCGGGACTTACCACTATAGGCCGATTCCAACAAGATACTCTAGGGT[C/T]
GAAGTTGAGCTGGTGGAAGCCGCGTACGAGGACCTCGAGTTGGACTACCCAGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCACGCCATTATAC
GTATAATGGCGTGGCTTGTGTCTCGTAGATGCGTCTCACCGTCTCCTCCTGGGTAGTCCAACTCGAGGTCCTCGTACGCGGCTTCCACCAGCTCAACTTC[G/A]
ACCCTAGAGTATCTTGTTGGAATCGGCCTATAGTGGTAAGTCCCGGAAGGGTCCGTTGGGATGGCCATTCCAAACGCCACCTTCACGTGATGAGAGGTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 34.10% | 0.17% | 0.17% | NA |
| All Indica | 2759 | 61.30% | 38.30% | 0.14% | 0.25% | NA |
| All Japonica | 1512 | 65.10% | 34.70% | 0.20% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.10% | 10.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 57.20% | 42.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 38.30% | 61.00% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 69.50% | 30.20% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 94.00% | 5.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 24.60% | 75.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.10% | 41.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 28.90% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506632469 | C -> T | LOC_Os05g11680-LOC_Os05g11700 | intergenic_region ; MODIFIER | silent_mutation | Average:60.132; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| vg0506632469 | C -> DEL | N | N | silent_mutation | Average:60.132; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506632469 | 7.82E-06 | NA | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 1.40E-12 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 1.08E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 8.09E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 7.78E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 9.72E-06 | mr1595 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 2.09E-08 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | 5.32E-11 | NA | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | 2.11E-11 | 6.60E-17 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 4.37E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 4.23E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 1.74E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 7.21E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 1.43E-08 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | 1.17E-06 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | 1.05E-07 | 1.12E-14 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506632469 | NA | 7.89E-10 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |