\
| Variant ID: vg0506631637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6631637 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 309. )
GTCAACAAGGGCAGGGGATGATGGAGAGAAACAAAGAAAATGCCGCCAAGAAGAAGTACCATCACCACTTGGGGTCAGGCGGCTATAGCATCGCAATGCC[G/A]
AAGTGGGAGGAGATGGAGGCAAGTTTGATTGAGAGGGGTATCGAACCGGCCAACGCTAAATGGCCGGATCGATCAAAGTTCTGGTACTATGCTCACGGTG
CACCGTGAGCATAGTACCAGAACTTTGATCGATCCGGCCATTTAGCGTTGGCCGGTTCGATACCCCTCTCAATCAAACTTGCCTCCATCTCCTCCCACTT[C/T]
GGCATTGCGATGCTATAGCCGCCTGACCCCAAGTGGTGATGGTACTTCTTCTTGGCGGCATTTTCTTTGTTTCTCTCCATCATCCCCTGCCCTTGTTGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 1.00% | 3.34% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 0.20% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 44.20% | 7.40% | 48.33% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 0.90% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.10% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 0.10% | 2.16% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506631637 | G -> A | LOC_Os05g11680.1 | upstream_gene_variant ; 4897.0bp to feature; MODIFIER | silent_mutation | Average:57.743; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0506631637 | G -> A | LOC_Os05g11680-LOC_Os05g11700 | intergenic_region ; MODIFIER | silent_mutation | Average:57.743; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506631637 | 1.82E-07 | NA | mr1064 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631637 | NA | 9.44E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631637 | NA | 3.10E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631637 | NA | 1.34E-09 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631637 | NA | 2.61E-09 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631637 | NA | 9.48E-08 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631637 | NA | 1.20E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631637 | 5.08E-06 | 1.79E-15 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631637 | NA | 9.95E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506631637 | NA | 2.90E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |