\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506624382:

Variant ID: vg0506624382 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6624382
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCTTGGAATTCTATCTTGTTTGGCCGCAATCACAGAAGCAAGGTGCTGCGTCACCTGTATTGGGCGTCCTCCTTCCAACGGATCCAGCCTCATCTCG[A/G]
AATTCTATCTCGTTTGGCCGCAATCACAGAAGCAAGGTGCTGCGTCACCTGTATTGGGCCAATGAGCTTGTAACTTTGTTTGGGACCCTGGCCCATGTGG

Reverse complement sequence

CCACATGGGCCAGGGTCCCAAACAAAGTTACAAGCTCATTGGCCCAATACAGGTGACGCAGCACCTTGCTTCTGTGATTGCGGCCAAACGAGATAGAATT[T/C]
CGAGATGAGGCTGGATCCGTTGGAAGGAGGACGCCCAATACAGGTGACGCAGCACCTTGCTTCTGTGATTGCGGCCAAACAAGATAGAATTCCAAGATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 29.60% 2.14% 12.40% NA
All Indica  2759 55.50% 33.30% 2.65% 8.59% NA
All Japonica  1512 60.80% 19.20% 1.65% 18.32% NA
Aus  269 17.10% 60.60% 0.37% 21.93% NA
Indica I  595 86.60% 5.90% 2.02% 5.55% NA
Indica II  465 54.40% 34.80% 3.23% 7.53% NA
Indica III  913 34.90% 55.90% 1.86% 7.34% NA
Indica Intermediate  786 56.50% 26.80% 3.69% 12.98% NA
Temperate Japonica  767 88.30% 8.00% 0.39% 3.39% NA
Tropical Japonica  504 22.20% 34.70% 2.18% 40.87% NA
Japonica Intermediate  241 53.90% 22.80% 4.56% 18.67% NA
VI/Aromatic  96 91.70% 1.00% 0.00% 7.29% NA
Intermediate  90 62.20% 28.90% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506624382 A -> DEL N N silent_mutation Average:55.298; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0506624382 A -> G LOC_Os05g11670.1 downstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:55.298; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0506624382 A -> G LOC_Os05g11680.1 downstream_gene_variant ; 290.0bp to feature; MODIFIER silent_mutation Average:55.298; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0506624382 A -> G LOC_Os05g11670-LOC_Os05g11680 intergenic_region ; MODIFIER silent_mutation Average:55.298; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506624382 NA 2.36E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506624382 NA 2.88E-06 mr1122 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506624382 NA 8.48E-08 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506624382 NA 7.42E-06 mr1401 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506624382 NA 2.63E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506624382 NA 6.07E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506624382 NA 4.81E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506624382 NA 4.98E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506624382 NA 8.08E-07 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251