\
| Variant ID: vg0506624382 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6624382 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 99. )
TCATCTTGGAATTCTATCTTGTTTGGCCGCAATCACAGAAGCAAGGTGCTGCGTCACCTGTATTGGGCGTCCTCCTTCCAACGGATCCAGCCTCATCTCG[A/G]
AATTCTATCTCGTTTGGCCGCAATCACAGAAGCAAGGTGCTGCGTCACCTGTATTGGGCCAATGAGCTTGTAACTTTGTTTGGGACCCTGGCCCATGTGG
CCACATGGGCCAGGGTCCCAAACAAAGTTACAAGCTCATTGGCCCAATACAGGTGACGCAGCACCTTGCTTCTGTGATTGCGGCCAAACGAGATAGAATT[T/C]
CGAGATGAGGCTGGATCCGTTGGAAGGAGGACGCCCAATACAGGTGACGCAGCACCTTGCTTCTGTGATTGCGGCCAAACAAGATAGAATTCCAAGATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.90% | 29.60% | 2.14% | 12.40% | NA |
| All Indica | 2759 | 55.50% | 33.30% | 2.65% | 8.59% | NA |
| All Japonica | 1512 | 60.80% | 19.20% | 1.65% | 18.32% | NA |
| Aus | 269 | 17.10% | 60.60% | 0.37% | 21.93% | NA |
| Indica I | 595 | 86.60% | 5.90% | 2.02% | 5.55% | NA |
| Indica II | 465 | 54.40% | 34.80% | 3.23% | 7.53% | NA |
| Indica III | 913 | 34.90% | 55.90% | 1.86% | 7.34% | NA |
| Indica Intermediate | 786 | 56.50% | 26.80% | 3.69% | 12.98% | NA |
| Temperate Japonica | 767 | 88.30% | 8.00% | 0.39% | 3.39% | NA |
| Tropical Japonica | 504 | 22.20% | 34.70% | 2.18% | 40.87% | NA |
| Japonica Intermediate | 241 | 53.90% | 22.80% | 4.56% | 18.67% | NA |
| VI/Aromatic | 96 | 91.70% | 1.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 62.20% | 28.90% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506624382 | A -> DEL | N | N | silent_mutation | Average:55.298; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0506624382 | A -> G | LOC_Os05g11670.1 | downstream_gene_variant ; 1555.0bp to feature; MODIFIER | silent_mutation | Average:55.298; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0506624382 | A -> G | LOC_Os05g11680.1 | downstream_gene_variant ; 290.0bp to feature; MODIFIER | silent_mutation | Average:55.298; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0506624382 | A -> G | LOC_Os05g11670-LOC_Os05g11680 | intergenic_region ; MODIFIER | silent_mutation | Average:55.298; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506624382 | NA | 2.36E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506624382 | NA | 2.88E-06 | mr1122 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506624382 | NA | 8.48E-08 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506624382 | NA | 7.42E-06 | mr1401 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506624382 | NA | 2.63E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506624382 | NA | 6.07E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506624382 | NA | 4.81E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506624382 | NA | 4.98E-08 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506624382 | NA | 8.08E-07 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |