Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506623100:

Variant ID: vg0506623100 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6623100
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAATCAAATTGAAATCATCCATATGCTAGTTATATATGATTATTAGAATTTTTAAAAGTTTTAAATCATGCACGTGGTATTTACATATGTTAATTAGA[C/A]
TTTTCAATAATTTATTATCATGATATGCTAATTACATATGATTATTAGATTTTTTATTAATTATGTATGATTATTATAATTTTTGTCAAATTGAAATCAT

Reverse complement sequence

ATGATTTCAATTTGACAAAAATTATAATAATCATACATAATTAATAAAAAATCTAATAATCATATGTAATTAGCATATCATGATAATAAATTATTGAAAA[G/T]
TCTAATTAACATATGTAAATACCACGTGCATGATTTAAAACTTTTAAAAATTCTAATAATCATATATAACTAGCATATGGATGATTTCAATTTGATTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.80%	21.00%	1.44%	3.75%	NA
All Indica	2759	58.00%	35.30%	2.28%	4.35%	NA
All Japonica	1512	99.50%	0.40%	0.07%	0.07%	NA
Aus	269	77.30%	1.10%	0.74%	20.82%	NA
Indica I	595	86.20%	10.90%	0.17%	2.69%	NA
Indica II	465	57.20%	37.00%	4.73%	1.08%	NA
Indica III	913	36.50%	57.90%	2.74%	2.85%	NA
Indica Intermediate	786	62.20%	26.60%	1.91%	9.29%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	8.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506623100	C -> DEL	N	N	silent_mutation	Average:13.671; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0506623100	C -> A	LOC_Os05g11670.1	downstream_gene_variant ; 273.0bp to feature; MODIFIER	silent_mutation	Average:13.671; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0506623100	C -> A	LOC_Os05g11680.1	downstream_gene_variant ; 1572.0bp to feature; MODIFIER	silent_mutation	Average:13.671; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0506623100	C -> A	LOC_Os05g11670-LOC_Os05g11680	intergenic_region ; MODIFIER	silent_mutation	Average:13.671; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506623100	1.81E-08	2.14E-28	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	9.72E-07	3.63E-12	mr1039	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	NA	5.97E-07	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	NA	7.09E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	NA	6.38E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	7.45E-08	NA	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	3.54E-06	3.89E-09	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	9.18E-11	2.68E-35	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	4.26E-07	3.02E-15	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	1.98E-09	NA	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506623100	6.04E-07	7.19E-14	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251