Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506620144:

Variant ID: vg0506620144 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6620144
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTTAGCCCCAGTTCATAACACCAACCGGGACTAAAGTCCCACCCCTATATATATGTCTTCTTCCTCCTCCAGCCCGAGCAAGCTTCAAAATTTCTTC[A/G]
AAAAAGAGGGGAGGTCATGCCAAAATTGATAGTGAATTTATTTTGGTGATTATATACAAATCGTAGGTGCCTAAAAGGTTAGTAACTTCAACCTCCAATG

Reverse complement sequence

CATTGGAGGTTGAAGTTACTAACCTTTTAGGCACCTACGATTTGTATATAATCACCAAAATAAATTCACTATCAATTTTGGCATGACCTCCCCTCTTTTT[T/C]
GAAGAAATTTTGAAGCTTGCTCGGGCTGGAGGAGGAAGAAGACATATATATAGGGGTGGGACTTTAGTCCCGGTTGGTGTTATGAACTGGGGCTAAAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 30.40% 3.24% 0.00% NA
All Indica  2759 62.20% 32.40% 5.36% 0.00% NA
All Japonica  1512 65.50% 34.20% 0.26% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 88.60% 9.60% 1.85% 0.00% NA
Indica II  465 57.60% 39.40% 3.01% 0.00% NA
Indica III  913 42.20% 50.40% 7.45% 0.00% NA
Indica Intermediate  786 68.30% 24.70% 7.00% 0.00% NA
Temperate Japonica  767 94.40% 5.50% 0.13% 0.00% NA
Tropical Japonica  504 25.20% 74.60% 0.20% 0.00% NA
Japonica Intermediate  241 58.10% 41.10% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506620144 A -> G LOC_Os05g11670.1 upstream_gene_variant ; 774.0bp to feature; MODIFIER silent_mutation Average:28.972; most accessible tissue: Minghui63 root, score: 36.81 N N N N
vg0506620144 A -> G LOC_Os05g11660.1 downstream_gene_variant ; 4613.0bp to feature; MODIFIER silent_mutation Average:28.972; most accessible tissue: Minghui63 root, score: 36.81 N N N N
vg0506620144 A -> G LOC_Os05g11680.1 downstream_gene_variant ; 4528.0bp to feature; MODIFIER silent_mutation Average:28.972; most accessible tissue: Minghui63 root, score: 36.81 N N N N
vg0506620144 A -> G LOC_Os05g11660-LOC_Os05g11670 intergenic_region ; MODIFIER silent_mutation Average:28.972; most accessible tissue: Minghui63 root, score: 36.81 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506620144 NA 1.23E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 5.04E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 6.41E-08 mr1308 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 7.12E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 7.00E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 1.89E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 4.87E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 1.62E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 2.33E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 4.19E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 3.07E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144 NA 1.11E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251