\
| Variant ID: vg0506620144 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6620144 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 117. )
ATCTTTAGCCCCAGTTCATAACACCAACCGGGACTAAAGTCCCACCCCTATATATATGTCTTCTTCCTCCTCCAGCCCGAGCAAGCTTCAAAATTTCTTC[A/G]
AAAAAGAGGGGAGGTCATGCCAAAATTGATAGTGAATTTATTTTGGTGATTATATACAAATCGTAGGTGCCTAAAAGGTTAGTAACTTCAACCTCCAATG
CATTGGAGGTTGAAGTTACTAACCTTTTAGGCACCTACGATTTGTATATAATCACCAAAATAAATTCACTATCAATTTTGGCATGACCTCCCCTCTTTTT[T/C]
GAAGAAATTTTGAAGCTTGCTCGGGCTGGAGGAGGAAGAAGACATATATATAGGGGTGGGACTTTAGTCCCGGTTGGTGTTATGAACTGGGGCTAAAGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 30.40% | 3.24% | 0.00% | NA |
| All Indica | 2759 | 62.20% | 32.40% | 5.36% | 0.00% | NA |
| All Japonica | 1512 | 65.50% | 34.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 88.60% | 9.60% | 1.85% | 0.00% | NA |
| Indica II | 465 | 57.60% | 39.40% | 3.01% | 0.00% | NA |
| Indica III | 913 | 42.20% | 50.40% | 7.45% | 0.00% | NA |
| Indica Intermediate | 786 | 68.30% | 24.70% | 7.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.40% | 5.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 25.20% | 74.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.10% | 41.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506620144 | A -> G | LOC_Os05g11670.1 | upstream_gene_variant ; 774.0bp to feature; MODIFIER | silent_mutation | Average:28.972; most accessible tissue: Minghui63 root, score: 36.81 | N | N | N | N |
| vg0506620144 | A -> G | LOC_Os05g11660.1 | downstream_gene_variant ; 4613.0bp to feature; MODIFIER | silent_mutation | Average:28.972; most accessible tissue: Minghui63 root, score: 36.81 | N | N | N | N |
| vg0506620144 | A -> G | LOC_Os05g11680.1 | downstream_gene_variant ; 4528.0bp to feature; MODIFIER | silent_mutation | Average:28.972; most accessible tissue: Minghui63 root, score: 36.81 | N | N | N | N |
| vg0506620144 | A -> G | LOC_Os05g11660-LOC_Os05g11670 | intergenic_region ; MODIFIER | silent_mutation | Average:28.972; most accessible tissue: Minghui63 root, score: 36.81 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506620144 | NA | 1.23E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 5.04E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 6.41E-08 | mr1308 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 7.12E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 7.00E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 1.89E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 4.87E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 1.62E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 2.33E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 4.19E-06 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 3.07E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506620144 | NA | 1.11E-06 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |