Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506620144:

Variant ID: vg0506620144 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6620144
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTTAGCCCCAGTTCATAACACCAACCGGGACTAAAGTCCCACCCCTATATATATGTCTTCTTCCTCCTCCAGCCCGAGCAAGCTTCAAAATTTCTTC[A/G]
AAAAAGAGGGGAGGTCATGCCAAAATTGATAGTGAATTTATTTTGGTGATTATATACAAATCGTAGGTGCCTAAAAGGTTAGTAACTTCAACCTCCAATG

Reverse complement sequence

CATTGGAGGTTGAAGTTACTAACCTTTTAGGCACCTACGATTTGTATATAATCACCAAAATAAATTCACTATCAATTTTGGCATGACCTCCCCTCTTTTT[T/C]
GAAGAAATTTTGAAGCTTGCTCGGGCTGGAGGAGGAAGAAGACATATATATAGGGGTGGGACTTTAGTCCCGGTTGGTGTTATGAACTGGGGCTAAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	30.40%	3.24%	0.00%	NA
All Indica	2759	62.20%	32.40%	5.36%	0.00%	NA
All Japonica	1512	65.50%	34.20%	0.26%	0.00%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	88.60%	9.60%	1.85%	0.00%	NA
Indica II	465	57.60%	39.40%	3.01%	0.00%	NA
Indica III	913	42.20%	50.40%	7.45%	0.00%	NA
Indica Intermediate	786	68.30%	24.70%	7.00%	0.00%	NA
Temperate Japonica	767	94.40%	5.50%	0.13%	0.00%	NA
Tropical Japonica	504	25.20%	74.60%	0.20%	0.00%	NA
Japonica Intermediate	241	58.10%	41.10%	0.83%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506620144	A -> G	LOC_Os05g11670.1	upstream_gene_variant ; 774.0bp to feature; MODIFIER	silent_mutation	Average:28.972; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg0506620144	A -> G	LOC_Os05g11660.1	downstream_gene_variant ; 4613.0bp to feature; MODIFIER	silent_mutation	Average:28.972; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg0506620144	A -> G	LOC_Os05g11680.1	downstream_gene_variant ; 4528.0bp to feature; MODIFIER	silent_mutation	Average:28.972; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg0506620144	A -> G	LOC_Os05g11660-LOC_Os05g11670	intergenic_region ; MODIFIER	silent_mutation	Average:28.972; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506620144	NA	1.23E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	5.04E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	6.41E-08	mr1308	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	7.12E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	7.00E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	1.89E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	4.87E-06	mr1520	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	1.62E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	2.33E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	4.19E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	3.07E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506620144	NA	1.11E-06	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251