\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506611180:

Variant ID: vg0506611180 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6611180
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGTCGGCCTCATAGGTCCGAGCCCGGGAGACCGGATCTAGTCGAGGACGCGTTGGGTCTGGCTAGGAGACGTTGGCTCATGATGTACATTGCCTCGTC[A/C]
TACCCCCCCCCCCCTCCCAAGGACACCGAATCCAGTCGATGATACATTAGATCTGTCCGTCCCTCCCAACGCCTTGCCACACCTTTGTCAGCATCCATGG

Reverse complement sequence

CCATGGATGCTGACAAAGGTGTGGCAAGGCGTTGGGAGGGACGGACAGATCTAATGTATCATCGACTGGATTCGGTGTCCTTGGGAGGGGGGGGGGGGTA[T/G]
GACGAGGCAATGTACATCATGAGCCAACGTCTCCTAGCCAGACCCAACGCGTCCTCGACTAGATCCGGTCTCCCGGGCTCGGACCTATGAGGCCGACGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 15.00% 0.51% 28.37% NA
All Indica  2759 56.10% 2.10% 0.80% 40.96% NA
All Japonica  1512 60.60% 37.60% 0.00% 1.79% NA
Aus  269 15.60% 23.00% 0.00% 61.34% NA
Indica I  595 86.40% 0.00% 0.00% 13.61% NA
Indica II  465 54.60% 0.90% 1.51% 43.01% NA
Indica III  913 35.80% 3.20% 0.77% 60.24% NA
Indica Intermediate  786 57.80% 3.20% 1.02% 38.04% NA
Temperate Japonica  767 87.90% 11.70% 0.00% 0.39% NA
Tropical Japonica  504 22.20% 74.60% 0.00% 3.17% NA
Japonica Intermediate  241 54.40% 42.30% 0.00% 3.32% NA
VI/Aromatic  96 91.70% 3.10% 0.00% 5.21% NA
Intermediate  90 63.30% 18.90% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506611180 A -> DEL N N silent_mutation Average:79.264; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0506611180 A -> C LOC_Os05g11650.1 upstream_gene_variant ; 3435.0bp to feature; MODIFIER silent_mutation Average:79.264; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0506611180 A -> C LOC_Os05g11660.1 upstream_gene_variant ; 3843.0bp to feature; MODIFIER silent_mutation Average:79.264; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0506611180 A -> C LOC_Os05g11650-LOC_Os05g11660 intergenic_region ; MODIFIER silent_mutation Average:79.264; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0506611180 A C 0.08 0.06 0.04 0.09 0.07 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506611180 NA 6.06E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 1.81E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 1.28E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 6.75E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 5.11E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 7.43E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 1.30E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 8.11E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 4.18E-09 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 2.29E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 5.49E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 4.11E-06 NA mr1794_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 7.34E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 1.89E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 6.09E-12 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 1.17E-12 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 3.71E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506611180 NA 5.24E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251