Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0506583308:

Variant ID: vg0506583308 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6583308
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

AACAATCTAATGAACTCACCAAAAACAAGATTGTTTGGCAGTCCAATTTTGGACATATATTGGAGAAGTATATTTATATAGTGTCACATATATTGGTTGC[G/T]
GCAATCATGTGTGCTAATAAAATTGACTATATATGAATTTGATTATTATTGCCTTTCTCAATCTTGCCCGTTTAGTTCAAGTCATGTGCAATTGCGTGCT

Reverse complement sequence

AGCACGCAATTGCACATGACTTGAACTAAACGGGCAAGATTGAGAAAGGCAATAATAATCAAATTCATATATAGTCAATTTTATTAGCACACATGATTGC[C/A]
GCAACCAATATATGTGACACTATATAAATATACTTCTCCAATATATGTCCAAAATTGGACTGCCAAACAATCTTGTTTTTGGTGAGTTCATTAGATTGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.90%	37.70%	0.30%	0.08%	NA
All Indica	2759	65.40%	34.20%	0.25%	0.14%	NA
All Japonica	1512	61.60%	38.00%	0.40%	0.00%	NA
Aus	269	15.60%	84.40%	0.00%	0.00%	NA
Indica I	595	85.90%	13.80%	0.34%	0.00%	NA
Indica II	465	81.30%	18.70%	0.00%	0.00%	NA
Indica III	913	46.70%	52.90%	0.33%	0.11%	NA
Indica Intermediate	786	62.30%	37.00%	0.25%	0.38%	NA
Temperate Japonica	767	90.20%	9.40%	0.39%	0.00%	NA
Tropical Japonica	504	21.80%	77.80%	0.40%	0.00%	NA
Japonica Intermediate	241	53.50%	46.10%	0.41%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506583308	G -> T	LOC_Os05g11620.1	downstream_gene_variant ; 420.0bp to feature; MODIFIER	silent_mutation	Average:45.727; most accessible tissue: Callus, score: 78.517	N	N	N	N
vg0506583308	G -> T	LOC_Os05g11620-LOC_Os05g11630	intergenic_region ; MODIFIER	silent_mutation	Average:45.727; most accessible tissue: Callus, score: 78.517	N	N	N	N
vg0506583308	G -> DEL	N	N	silent_mutation	Average:45.727; most accessible tissue: Callus, score: 78.517	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506583308	NA	1.21E-07	mr1124	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506583308	NA	1.46E-06	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506583308	NA	9.20E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506583308	NA	3.78E-06	mr1940	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506583308	NA	3.55E-06	mr1124_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506583308	NA	2.03E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506583308	NA	7.82E-06	mr1425_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506583308	NA	1.38E-06	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506583308	NA	3.30E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506583308	NA	1.62E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251