Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0506577678:

Variant ID: vg0506577678 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6577678
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

ATAATGTAAGACTTTCAAGCATTGTCCACATTCATATAGATGTGCCTAGATTAATTAACATCTATATGTATGTGGACAATGCTAGAAATTCTTACATTGT[G/A]
AAACGGAGTAAGTATTTGTTTAGAATTATTCTTTTGTCTGTTTTTATTCTTTTTATGTGGTGTTTGCAAATCCTCAACAAAGATCTAGAAAGCCTTGTCT

Reverse complement sequence

AGACAAGGCTTTCTAGATCTTTGTTGAGGATTTGCAAACACCACATAAAAAGAATAAAAACAGACAAAAGAATAATTCTAAACAAATACTTACTCCGTTT[C/T]
ACAATGTAAGAATTTCTAGCATTGTCCACATACATATAGATGTTAATTAATCTAGGCACATCTATATGAATGTGGACAATGCTTGAAAGTCTTACATTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	7.70%	0.59%	0.00%	NA
All Indica	2759	86.30%	12.80%	0.94%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	0.70%	0.67%	0.00%	NA
Indica II	465	69.90%	29.50%	0.65%	0.00%	NA
Indica III	913	88.90%	11.00%	0.11%	0.00%	NA
Indica Intermediate	786	83.50%	14.20%	2.29%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506577678	G -> A	LOC_Os05g11620.1	upstream_gene_variant ; 4455.0bp to feature; MODIFIER	silent_mutation	Average:37.298; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg0506577678	G -> A	LOC_Os05g11610.1	downstream_gene_variant ; 963.0bp to feature; MODIFIER	silent_mutation	Average:37.298; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg0506577678	G -> A	LOC_Os05g11610-LOC_Os05g11620	intergenic_region ; MODIFIER	silent_mutation	Average:37.298; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506577678	1.10E-09	1.44E-31	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678	3.38E-07	3.59E-16	mr1039	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678	1.55E-07	NA	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678	1.84E-06	2.11E-10	mr1632	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678	4.43E-10	5.16E-32	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678	5.79E-07	3.07E-15	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678	3.03E-11	NA	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678	2.61E-08	5.94E-14	mr1632_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251