\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506577678:

Variant ID: vg0506577678 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6577678
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATGTAAGACTTTCAAGCATTGTCCACATTCATATAGATGTGCCTAGATTAATTAACATCTATATGTATGTGGACAATGCTAGAAATTCTTACATTGT[G/A]
AAACGGAGTAAGTATTTGTTTAGAATTATTCTTTTGTCTGTTTTTATTCTTTTTATGTGGTGTTTGCAAATCCTCAACAAAGATCTAGAAAGCCTTGTCT

Reverse complement sequence

AGACAAGGCTTTCTAGATCTTTGTTGAGGATTTGCAAACACCACATAAAAAGAATAAAAACAGACAAAAGAATAATTCTAAACAAATACTTACTCCGTTT[C/T]
ACAATGTAAGAATTTCTAGCATTGTCCACATACATATAGATGTTAATTAATCTAGGCACATCTATATGAATGTGGACAATGCTTGAAAGTCTTACATTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 7.70% 0.59% 0.00% NA
All Indica  2759 86.30% 12.80% 0.94% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 0.70% 0.67% 0.00% NA
Indica II  465 69.90% 29.50% 0.65% 0.00% NA
Indica III  913 88.90% 11.00% 0.11% 0.00% NA
Indica Intermediate  786 83.50% 14.20% 2.29% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506577678 G -> A LOC_Os05g11620.1 upstream_gene_variant ; 4455.0bp to feature; MODIFIER silent_mutation Average:37.298; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg0506577678 G -> A LOC_Os05g11610.1 downstream_gene_variant ; 963.0bp to feature; MODIFIER silent_mutation Average:37.298; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N
vg0506577678 G -> A LOC_Os05g11610-LOC_Os05g11620 intergenic_region ; MODIFIER silent_mutation Average:37.298; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506577678 1.10E-09 1.44E-31 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678 3.38E-07 3.59E-16 mr1039 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678 1.55E-07 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678 1.84E-06 2.11E-10 mr1632 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678 4.43E-10 5.16E-32 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678 5.79E-07 3.07E-15 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678 3.03E-11 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506577678 2.61E-08 5.94E-14 mr1632_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251