\
| Variant ID: vg0506577678 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6577678 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )
ATAATGTAAGACTTTCAAGCATTGTCCACATTCATATAGATGTGCCTAGATTAATTAACATCTATATGTATGTGGACAATGCTAGAAATTCTTACATTGT[G/A]
AAACGGAGTAAGTATTTGTTTAGAATTATTCTTTTGTCTGTTTTTATTCTTTTTATGTGGTGTTTGCAAATCCTCAACAAAGATCTAGAAAGCCTTGTCT
AGACAAGGCTTTCTAGATCTTTGTTGAGGATTTGCAAACACCACATAAAAAGAATAAAAACAGACAAAAGAATAATTCTAAACAAATACTTACTCCGTTT[C/T]
ACAATGTAAGAATTTCTAGCATTGTCCACATACATATAGATGTTAATTAATCTAGGCACATCTATATGAATGTGGACAATGCTTGAAAGTCTTACATTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.70% | 7.70% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 86.30% | 12.80% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.70% | 0.67% | 0.00% | NA |
| Indica II | 465 | 69.90% | 29.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 88.90% | 11.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.50% | 14.20% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506577678 | G -> A | LOC_Os05g11620.1 | upstream_gene_variant ; 4455.0bp to feature; MODIFIER | silent_mutation | Average:37.298; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| vg0506577678 | G -> A | LOC_Os05g11610.1 | downstream_gene_variant ; 963.0bp to feature; MODIFIER | silent_mutation | Average:37.298; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| vg0506577678 | G -> A | LOC_Os05g11610-LOC_Os05g11620 | intergenic_region ; MODIFIER | silent_mutation | Average:37.298; most accessible tissue: Zhenshan97 young leaf, score: 54.618 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506577678 | 1.10E-09 | 1.44E-31 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506577678 | 3.38E-07 | 3.59E-16 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506577678 | 1.55E-07 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506577678 | 1.84E-06 | 2.11E-10 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506577678 | 4.43E-10 | 5.16E-32 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506577678 | 5.79E-07 | 3.07E-15 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506577678 | 3.03E-11 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506577678 | 2.61E-08 | 5.94E-14 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |