Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506565714:

Variant ID: vg0506565714 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6565714
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAAACAATGTATTGCGTAAGTTATTCCAATCATCAATTTTCTTTATTTCTTATCATGTGGCATCTTTTAGAAATATAAAAATAAGACCTCTCACGGAG[G/A]
CGAGTTCTTAATAATCTATAAAAATATACTCCCTCTGTTCCAAAAAAAATTTAATCTAGGAGGGGACGTGACCCCTTCTAGGACAATGAATTTGGACTAC

Reverse complement sequence

GTAGTCCAAATTCATTGTCCTAGAAGGGGTCACGTCCCCTCCTAGATTAAATTTTTTTTGGAACAGAGGGAGTATATTTTTATAGATTATTAAGAACTCG[C/T]
CTCCGTGAGAGGTCTTATTTTTATATTTCTAAAAGATGCCACATGATAAGAAATAAAGAAAATTGATGATTGGAATAACTTACGCAATACATTGTTTTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	15.60%	0.68%	0.00%	NA
All Indica	2759	73.10%	25.80%	1.16%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	85.20%	13.10%	1.68%	0.00%	NA
Indica II	465	41.30%	57.00%	1.72%	0.00%	NA
Indica III	913	84.60%	15.20%	0.22%	0.00%	NA
Indica Intermediate	786	69.30%	29.10%	1.53%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506565714	G -> A	LOC_Os05g11590.1	upstream_gene_variant ; 3772.0bp to feature; MODIFIER	silent_mutation	Average:48.996; most accessible tissue: Callus, score: 81.22	N	N	N	N
vg0506565714	G -> A	LOC_Os05g11590-LOC_Os05g11600	intergenic_region ; MODIFIER	silent_mutation	Average:48.996; most accessible tissue: Callus, score: 81.22	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506565714	NA	4.19E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714	NA	2.18E-11	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714	NA	1.91E-14	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714	NA	3.17E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714	NA	3.55E-15	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714	NA	3.01E-09	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714	7.26E-08	3.63E-11	mr1593	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714	8.45E-07	1.52E-14	mr1593	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714	NA	1.70E-12	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714	NA	2.94E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251