\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506565714:

Variant ID: vg0506565714 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6565714
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAAACAATGTATTGCGTAAGTTATTCCAATCATCAATTTTCTTTATTTCTTATCATGTGGCATCTTTTAGAAATATAAAAATAAGACCTCTCACGGAG[G/A]
CGAGTTCTTAATAATCTATAAAAATATACTCCCTCTGTTCCAAAAAAAATTTAATCTAGGAGGGGACGTGACCCCTTCTAGGACAATGAATTTGGACTAC

Reverse complement sequence

GTAGTCCAAATTCATTGTCCTAGAAGGGGTCACGTCCCCTCCTAGATTAAATTTTTTTTGGAACAGAGGGAGTATATTTTTATAGATTATTAAGAACTCG[C/T]
CTCCGTGAGAGGTCTTATTTTTATATTTCTAAAAGATGCCACATGATAAGAAATAAAGAAAATTGATGATTGGAATAACTTACGCAATACATTGTTTTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 15.60% 0.68% 0.00% NA
All Indica  2759 73.10% 25.80% 1.16% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.20% 13.10% 1.68% 0.00% NA
Indica II  465 41.30% 57.00% 1.72% 0.00% NA
Indica III  913 84.60% 15.20% 0.22% 0.00% NA
Indica Intermediate  786 69.30% 29.10% 1.53% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506565714 G -> A LOC_Os05g11590.1 upstream_gene_variant ; 3772.0bp to feature; MODIFIER silent_mutation Average:48.996; most accessible tissue: Callus, score: 81.22 N N N N
vg0506565714 G -> A LOC_Os05g11590-LOC_Os05g11600 intergenic_region ; MODIFIER silent_mutation Average:48.996; most accessible tissue: Callus, score: 81.22 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506565714 NA 4.19E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714 NA 2.18E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714 NA 1.91E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714 NA 3.17E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714 NA 3.55E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714 NA 3.01E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714 7.26E-08 3.63E-11 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714 8.45E-07 1.52E-14 mr1593 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714 NA 1.70E-12 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506565714 NA 2.94E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251