\
| Variant ID: vg0506565714 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6565714 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 122. )
GTAAAACAATGTATTGCGTAAGTTATTCCAATCATCAATTTTCTTTATTTCTTATCATGTGGCATCTTTTAGAAATATAAAAATAAGACCTCTCACGGAG[G/A]
CGAGTTCTTAATAATCTATAAAAATATACTCCCTCTGTTCCAAAAAAAATTTAATCTAGGAGGGGACGTGACCCCTTCTAGGACAATGAATTTGGACTAC
GTAGTCCAAATTCATTGTCCTAGAAGGGGTCACGTCCCCTCCTAGATTAAATTTTTTTTGGAACAGAGGGAGTATATTTTTATAGATTATTAAGAACTCG[C/T]
CTCCGTGAGAGGTCTTATTTTTATATTTCTAAAAGATGCCACATGATAAGAAATAAAGAAAATTGATGATTGGAATAACTTACGCAATACATTGTTTTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 15.60% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 73.10% | 25.80% | 1.16% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.20% | 13.10% | 1.68% | 0.00% | NA |
| Indica II | 465 | 41.30% | 57.00% | 1.72% | 0.00% | NA |
| Indica III | 913 | 84.60% | 15.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 69.30% | 29.10% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506565714 | G -> A | LOC_Os05g11590.1 | upstream_gene_variant ; 3772.0bp to feature; MODIFIER | silent_mutation | Average:48.996; most accessible tissue: Callus, score: 81.22 | N | N | N | N |
| vg0506565714 | G -> A | LOC_Os05g11590-LOC_Os05g11600 | intergenic_region ; MODIFIER | silent_mutation | Average:48.996; most accessible tissue: Callus, score: 81.22 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506565714 | NA | 4.19E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506565714 | NA | 2.18E-11 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506565714 | NA | 1.91E-14 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506565714 | NA | 3.17E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506565714 | NA | 3.55E-15 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506565714 | NA | 3.01E-09 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506565714 | 7.26E-08 | 3.63E-11 | mr1593 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506565714 | 8.45E-07 | 1.52E-14 | mr1593 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506565714 | NA | 1.70E-12 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506565714 | NA | 2.94E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |