\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506467528:

Variant ID: vg0506467528 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6467528
Reference Allele: AAlternative Allele: T,G
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, G: 0.24, T: 0.14, others allele: 0.00, population size: 141. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCACATTCATATTGATACTAATGAATCTAGACAATGTGGAAAATACTAGAATGACTTACATTGTAAAACGGAGGGAGTACTTTTTAACGCAAATCTAC[A/T,G]
TATACCATTTTCTTTTAAAAAAACTAAATATTTGACAAATTATTGATAGTTAAAGTTTCAAATATTGTCCCAAACATCTAATATTTATAATCGGAGAGAG

Reverse complement sequence

CTCTCTCCGATTATAAATATTAGATGTTTGGGACAATATTTGAAACTTTAACTATCAATAATTTGTCAAATATTTAGTTTTTTTAAAAGAAAATGGTATA[T/A,C]
GTAGATTTGCGTTAAAAAGTACTCCCTCCGTTTTACAATGTAAGTCATTCTAGTATTTTCCACATTGTCTAGATTCATTAGTATCAATATGAATGTGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 19.90% 0.02% 0.00% G: 0.04%
All Indica  2759 85.00% 15.00% 0.00% 0.00% NA
All Japonica  1512 81.20% 18.80% 0.00% 0.00% NA
Aus  269 16.00% 84.00% 0.00% 0.00% NA
Indica I  595 77.50% 22.50% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 89.60% 10.40% 0.00% 0.00% NA
Indica Intermediate  786 78.60% 21.40% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 56.70% 43.30% 0.00% 0.00% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 82.20% 14.40% 1.11% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506467528 A -> T LOC_Os05g11428.1 downstream_gene_variant ; 607.0bp to feature; MODIFIER silent_mutation Average:48.714; most accessible tissue: Callus, score: 69.902 N N N N
vg0506467528 A -> T LOC_Os05g11414-LOC_Os05g11428 intergenic_region ; MODIFIER silent_mutation Average:48.714; most accessible tissue: Callus, score: 69.902 N N N N
vg0506467528 A -> G LOC_Os05g11428.1 downstream_gene_variant ; 607.0bp to feature; MODIFIER silent_mutation Average:48.714; most accessible tissue: Callus, score: 69.902 N N N N
vg0506467528 A -> G LOC_Os05g11414-LOC_Os05g11428 intergenic_region ; MODIFIER silent_mutation Average:48.714; most accessible tissue: Callus, score: 69.902 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506467528 NA 4.76E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506467528 NA 2.41E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506467528 7.16E-08 7.15E-08 mr1929 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506467528 NA 3.35E-06 mr1124_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506467528 NA 6.14E-06 mr1642_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506467528 NA 7.94E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506467528 NA 9.48E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506467528 NA 2.93E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251