\
| Variant ID: vg0506467528 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6467528 |
| Reference Allele: A | Alternative Allele: T,G |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, G: 0.24, T: 0.14, others allele: 0.00, population size: 141. )
TTCCACATTCATATTGATACTAATGAATCTAGACAATGTGGAAAATACTAGAATGACTTACATTGTAAAACGGAGGGAGTACTTTTTAACGCAAATCTAC[A/T,G]
TATACCATTTTCTTTTAAAAAAACTAAATATTTGACAAATTATTGATAGTTAAAGTTTCAAATATTGTCCCAAACATCTAATATTTATAATCGGAGAGAG
CTCTCTCCGATTATAAATATTAGATGTTTGGGACAATATTTGAAACTTTAACTATCAATAATTTGTCAAATATTTAGTTTTTTTAAAAGAAAATGGTATA[T/A,C]
GTAGATTTGCGTTAAAAAGTACTCCCTCCGTTTTACAATGTAAGTCATTCTAGTATTTTCCACATTGTCTAGATTCATTAGTATCAATATGAATGTGGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.00% | 19.90% | 0.02% | 0.00% | G: 0.04% |
| All Indica | 2759 | 85.00% | 15.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.00% | 84.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.50% | 22.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.60% | 21.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 14.40% | 1.11% | 0.00% | G: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506467528 | A -> T | LOC_Os05g11428.1 | downstream_gene_variant ; 607.0bp to feature; MODIFIER | silent_mutation | Average:48.714; most accessible tissue: Callus, score: 69.902 | N | N | N | N |
| vg0506467528 | A -> T | LOC_Os05g11414-LOC_Os05g11428 | intergenic_region ; MODIFIER | silent_mutation | Average:48.714; most accessible tissue: Callus, score: 69.902 | N | N | N | N |
| vg0506467528 | A -> G | LOC_Os05g11428.1 | downstream_gene_variant ; 607.0bp to feature; MODIFIER | silent_mutation | Average:48.714; most accessible tissue: Callus, score: 69.902 | N | N | N | N |
| vg0506467528 | A -> G | LOC_Os05g11414-LOC_Os05g11428 | intergenic_region ; MODIFIER | silent_mutation | Average:48.714; most accessible tissue: Callus, score: 69.902 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506467528 | NA | 4.76E-06 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506467528 | NA | 2.41E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506467528 | 7.16E-08 | 7.15E-08 | mr1929 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506467528 | NA | 3.35E-06 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506467528 | NA | 6.14E-06 | mr1642_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506467528 | NA | 7.94E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506467528 | NA | 9.48E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506467528 | NA | 2.93E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |