\
| Variant ID: vg0506428153 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6428153 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, T: 0.07, others allele: 0.00, population size: 209. )
TTCCGAAACAATAGAACAACTGTGGCATGATATTATTTAATGTTTAATCTAAAGCATTGTTTGGTCGTAAAAAAATGTCACTCTGACTTCCATAGTCATT[G/T]
CTAATAAAATTTGCAAAAAAAAAATCAGGATGCCAGTTAGATTGAGTGTCATACTGTACAAACACTGGACTGTATATACCATTGTTGTGTTCATCTGTTT
AAACAGATGAACACAACAATGGTATATACAGTCCAGTGTTTGTACAGTATGACACTCAATCTAACTGGCATCCTGATTTTTTTTTTGCAAATTTTATTAG[C/A]
AATGACTATGGAAGTCAGAGTGACATTTTTTTACGACCAAACAATGCTTTAGATTAAACATTAAATAATATCATGCCACAGTTGTTCTATTGTTTCGGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.00% | 84.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 57.10% | 42.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506428153 | G -> T | LOC_Os05g11380.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.32; most accessible tissue: Zhenshan97 flower, score: 62.865 | N | N | N | N |
| vg0506428153 | G -> T | LOC_Os05g11380.2 | intron_variant ; MODIFIER | silent_mutation | Average:43.32; most accessible tissue: Zhenshan97 flower, score: 62.865 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506428153 | NA | 2.25E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 4.87E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 5.65E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 3.51E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 4.36E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 9.75E-13 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 1.10E-06 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | 6.47E-07 | 6.47E-07 | mr1929 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | 1.14E-08 | NA | mr1033_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 6.77E-12 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 2.10E-06 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 1.23E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 2.24E-18 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 6.29E-09 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 2.91E-07 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | 7.22E-06 | 4.39E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 4.12E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506428153 | NA | 3.82E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |