Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0506417689:

Variant ID: vg0506417689 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6417689
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATTATGACTACTATTATAAAAATTAAAAATATTTTTGCTAGTATCTTGATATGTCATCCACGGTTTTTAAGTTTGTTCATTTTTGGAAATACAGATCC[G/A]
TGTTTGAATTGGATTTTAAGTTTTTTTCCTTTGGGAAGTATAAAAGGAGTCGTATAAGAAATATTTTGAAAAAACTCACATGCTAACTTGAGACAATATG

Reverse complement sequence

CATATTGTCTCAAGTTAGCATGTGAGTTTTTTCAAAATATTTCTTATACGACTCCTTTTATACTTCCCAAAGGAAAAAAACTTAAAATCCAATTCAAACA[C/T]
GGATCTGTATTTCCAAAAATGAACAAACTTAAAAACCGTGGATGACATATCAAGATACTAGCAAAAATATTTTTAATTTTTATAATAGTAGTCATAATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.10%	5.80%	0.02%	2.07%	NA
All Indica	2759	94.10%	2.40%	0.00%	3.55%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	23.80%	75.80%	0.37%	0.00%	NA
Indica I	595	95.00%	1.00%	0.00%	4.03%	NA
Indica II	465	98.30%	1.10%	0.00%	0.65%	NA
Indica III	913	96.90%	1.20%	0.00%	1.86%	NA
Indica Intermediate	786	87.70%	5.50%	0.00%	6.87%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506417689	G -> DEL	N	N	silent_mutation	Average:69.424; most accessible tissue: Callus, score: 92.324	N	N	N	N
vg0506417689	G -> A	LOC_Os05g11360.1	upstream_gene_variant ; 560.0bp to feature; MODIFIER	silent_mutation	Average:69.424; most accessible tissue: Callus, score: 92.324	N	N	N	N
vg0506417689	G -> A	LOC_Os05g11370.1	upstream_gene_variant ; 1774.0bp to feature; MODIFIER	silent_mutation	Average:69.424; most accessible tissue: Callus, score: 92.324	N	N	N	N
vg0506417689	G -> A	LOC_Os05g11350.1	downstream_gene_variant ; 1326.0bp to feature; MODIFIER	silent_mutation	Average:69.424; most accessible tissue: Callus, score: 92.324	N	N	N	N
vg0506417689	G -> A	LOC_Os05g11360-LOC_Os05g11370	intergenic_region ; MODIFIER	silent_mutation	Average:69.424; most accessible tissue: Callus, score: 92.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506417689	NA	5.98E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506417689	NA	1.44E-21	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506417689	NA	1.14E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506417689	NA	5.00E-07	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506417689	NA	3.98E-11	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506417689	NA	8.99E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506417689	NA	3.22E-08	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506417689	NA	9.27E-10	mr1735	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506417689	NA	1.88E-19	mr1936	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506417689	NA	2.50E-22	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251