\
| Variant ID: vg0506412276 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 6412276 |
| Reference Allele: C | Alternative Allele: CG,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 200. )
TATAGGCTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATAGTATGGGGATCGTTGGTACTAGGATATATGCGAGACTGAGGTAAAAGAGATGGAGA[C/CG,T]
AGGGATTTTTATACAGGTTCGAGCCCCTGAATTGTCAGGTAATAACCCTACTCCTGTTGGTCGAAGCCGGTCGTTGCTCTTATTCACCATAATCACACCA
TGGTGTGATTATGGTGAATAAGAGCAACGACCGGCTTCGACCAACAGGAGTAGGGTTATTACCTGACAATTCAGGGGCTCGAACCTGTATAAAAATCCCT[G/CG,A]
TCTCCATCTCTTTTACCTCAGTCTCGCATATATCCTAGTACCAACGATCCCCATACTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGCCTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 10.00% | 1.59% | 1.48% | CG: 0.04% |
| All Indica | 2759 | 94.20% | 4.20% | 1.49% | 0.11% | CG: 0.04% |
| All Japonica | 1512 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.90% | 21.60% | 12.27% | 24.91% | CG: 0.37% |
| Indica I | 595 | 95.50% | 2.90% | 1.68% | 0.00% | NA |
| Indica II | 465 | 97.40% | 1.90% | 0.43% | 0.22% | NA |
| Indica III | 913 | 95.20% | 4.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 90.20% | 6.10% | 3.31% | 0.25% | CG: 0.13% |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506412276 | C -> T | LOC_Os05g11340.1 | upstream_gene_variant ; 2417.0bp to feature; MODIFIER | silent_mutation | Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412276 | C -> T | LOC_Os05g11350.1 | upstream_gene_variant ; 2468.0bp to feature; MODIFIER | silent_mutation | Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412276 | C -> T | LOC_Os05g11360.1 | downstream_gene_variant ; 4251.0bp to feature; MODIFIER | silent_mutation | Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412276 | C -> T | LOC_Os05g11340-LOC_Os05g11350 | intergenic_region ; MODIFIER | silent_mutation | Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412276 | C -> DEL | N | N | silent_mutation | Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412276 | C -> CG | LOC_Os05g11340.1 | upstream_gene_variant ; 2418.0bp to feature; MODIFIER | silent_mutation | Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412276 | C -> CG | LOC_Os05g11350.1 | upstream_gene_variant ; 2467.0bp to feature; MODIFIER | silent_mutation | Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412276 | C -> CG | LOC_Os05g11360.1 | downstream_gene_variant ; 4250.0bp to feature; MODIFIER | silent_mutation | Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0506412276 | C -> CG | LOC_Os05g11340-LOC_Os05g11350 | intergenic_region ; MODIFIER | silent_mutation | Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506412276 | 2.84E-06 | 6.23E-10 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412276 | 9.34E-08 | 9.33E-08 | mr1929 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412276 | 8.09E-06 | NA | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412276 | 4.89E-06 | 2.03E-08 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412276 | NA | 1.91E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412276 | 1.72E-09 | NA | mr1850_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412276 | 2.97E-08 | 2.24E-09 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506412276 | NA | 9.15E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |