\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506412276:

Variant ID: vg0506412276 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 6412276
Reference Allele: CAlternative Allele: CG,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TATAGGCTGTCGACGTTTGATGTCGCGATTCCGGTATTTGCATAGTATGGGGATCGTTGGTACTAGGATATATGCGAGACTGAGGTAAAAGAGATGGAGA[C/CG,T]
AGGGATTTTTATACAGGTTCGAGCCCCTGAATTGTCAGGTAATAACCCTACTCCTGTTGGTCGAAGCCGGTCGTTGCTCTTATTCACCATAATCACACCA

Reverse complement sequence

TGGTGTGATTATGGTGAATAAGAGCAACGACCGGCTTCGACCAACAGGAGTAGGGTTATTACCTGACAATTCAGGGGCTCGAACCTGTATAAAAATCCCT[G/CG,A]
TCTCCATCTCTTTTACCTCAGTCTCGCATATATCCTAGTACCAACGATCCCCATACTATGCAAATACCGGAATCGCGACATCAAACGTCGACAGCCTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 10.00% 1.59% 1.48% CG: 0.04%
All Indica  2759 94.20% 4.20% 1.49% 0.11% CG: 0.04%
All Japonica  1512 81.20% 18.80% 0.00% 0.00% NA
Aus  269 40.90% 21.60% 12.27% 24.91% CG: 0.37%
Indica I  595 95.50% 2.90% 1.68% 0.00% NA
Indica II  465 97.40% 1.90% 0.43% 0.22% NA
Indica III  913 95.20% 4.50% 0.33% 0.00% NA
Indica Intermediate  786 90.20% 6.10% 3.31% 0.25% CG: 0.13%
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 56.90% 43.10% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506412276 C -> T LOC_Os05g11340.1 upstream_gene_variant ; 2417.0bp to feature; MODIFIER silent_mutation Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412276 C -> T LOC_Os05g11350.1 upstream_gene_variant ; 2468.0bp to feature; MODIFIER silent_mutation Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412276 C -> T LOC_Os05g11360.1 downstream_gene_variant ; 4251.0bp to feature; MODIFIER silent_mutation Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412276 C -> T LOC_Os05g11340-LOC_Os05g11350 intergenic_region ; MODIFIER silent_mutation Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412276 C -> DEL N N silent_mutation Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412276 C -> CG LOC_Os05g11340.1 upstream_gene_variant ; 2418.0bp to feature; MODIFIER silent_mutation Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412276 C -> CG LOC_Os05g11350.1 upstream_gene_variant ; 2467.0bp to feature; MODIFIER silent_mutation Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412276 C -> CG LOC_Os05g11360.1 downstream_gene_variant ; 4250.0bp to feature; MODIFIER silent_mutation Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0506412276 C -> CG LOC_Os05g11340-LOC_Os05g11350 intergenic_region ; MODIFIER silent_mutation Average:46.989; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506412276 2.84E-06 6.23E-10 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412276 9.34E-08 9.33E-08 mr1929 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412276 8.09E-06 NA mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412276 4.89E-06 2.03E-08 mr1124_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412276 NA 1.91E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412276 1.72E-09 NA mr1850_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412276 2.97E-08 2.24E-09 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506412276 NA 9.15E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251