Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506308814:

Variant ID: vg0506308814 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 6308814
Reference Allele: C	Alternative Allele: T,CTCACAGAGATATTTTGAGTGAGTAGCATATTCCT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AATTCACAGAAGCCAAAACGGTATTAGTCACCTATTAGCCAATAGGGCGAGAACTAATTCCCTTTCTGGTTTTTTGGTTAGAAGGAAGTTGTAATTTCAT[C/T,CTCACAGAGATATTTTGAGTGAGTAGCATATTCCT]
TCACAGCTAGCTTGTGAGGATATTTTGAGTGAGTAGCATATTCCTTTCTTCCTCGAAAAAAAAAACATATCCTCCATGCCCCGAAGTTTTTGTTGTGGTT

Reverse complement sequence

AACCACAACAAAAACTTCGGGGCATGGAGGATATGTTTTTTTTTTCGAGGAAGAAAGGAATATGCTACTCACTCAAAATATCCTCACAAGCTAGCTGTGA[G/A,AGGAATATGCTACTCACTCAAAATATCTCTGTGAG]
ATGAAATTACAACTTCCTTCTAACCAAAAAACCAGAAAGGGAATTAGTTCTCGCCCTATTGGCTAATAGGTGACTAATACCGTTTTGGCTTCTGTGAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	18.90%	0.06%	0.00%	CTCACAGAGATATTTTGAGTGAGTAGCATATTCCT: 0.02%
All Indica	2759	97.00%	3.00%	0.00%	0.00%	NA
All Japonica	1512	60.80%	39.00%	0.20%	0.00%	NA
Aus	269	28.30%	71.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.30%	4.70%	0.00%	0.00%	NA
Indica III	913	98.20%	1.80%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.60%	0.00%	0.00%	NA
Temperate Japonica	767	94.30%	5.70%	0.00%	0.00%	NA
Tropical Japonica	504	14.30%	85.30%	0.40%	0.00%	NA
Japonica Intermediate	241	51.90%	47.70%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	5.20%	0.00%	0.00%	CTCACAGAGATATTTTGAGTGAGTAGCATATTCCT: 1.04%
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506308814	C -> T	LOC_Os05g11180.1	upstream_gene_variant ; 4172.0bp to feature; MODIFIER	silent_mutation	Average:59.171; most accessible tissue: Callus, score: 92.136	N	N	N	N
vg0506308814	C -> T	LOC_Os05g11170.1	downstream_gene_variant ; 2113.0bp to feature; MODIFIER	silent_mutation	Average:59.171; most accessible tissue: Callus, score: 92.136	N	N	N	N
vg0506308814	C -> T	LOC_Os05g11170-LOC_Os05g11180	intergenic_region ; MODIFIER	silent_mutation	Average:59.171; most accessible tissue: Callus, score: 92.136	N	N	N	N
vg0506308814	C -> CTCACAGAGATATTTTGAGTGAGTAGCATA TTCCT	LOC_Os05g11180.1	upstream_gene_variant ; 4171.0bp to feature; MODIFIER	silent_mutation	Average:59.171; most accessible tissue: Callus, score: 92.136	N	N	N	N
vg0506308814	C -> CTCACAGAGATATTTTGAGTGAGTAGCATA TTCCT	LOC_Os05g11170.1	downstream_gene_variant ; 2114.0bp to feature; MODIFIER	silent_mutation	Average:59.171; most accessible tissue: Callus, score: 92.136	N	N	N	N
vg0506308814	C -> CTCACAGAGATATTTTGAGTGAGTAGCATA TTCCT	LOC_Os05g11170-LOC_Os05g11180	intergenic_region ; MODIFIER	silent_mutation	Average:59.171; most accessible tissue: Callus, score: 92.136	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506308814	NA	8.93E-14	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506308814	NA	6.11E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	8.94E-09	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	3.69E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.33E-06	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	7.93E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.36E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.27E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	4.96E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	8.33E-10	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.57E-13	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	3.30E-09	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	6.89E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	4.53E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.17E-07	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.36E-06	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	3.24E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	5.85E-17	mr1047_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	2.36E-17	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	5.78E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	3.49E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.13E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	5.36E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	3.07E-07	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	8.44E-09	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.31E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	9.60E-10	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.04E-17	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	9.19E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	7.69E-15	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.07E-06	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	3.12E-13	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	9.89E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	2.17E-16	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	5.34E-12	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	4.59E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	7.41E-08	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	1.18E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814	NA	4.83E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251