\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506308814:

Variant ID: vg0506308814 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 6308814
Reference Allele: CAlternative Allele: T,CTCACAGAGATATTTTGAGTGAGTAGCATATTCCT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCACAGAAGCCAAAACGGTATTAGTCACCTATTAGCCAATAGGGCGAGAACTAATTCCCTTTCTGGTTTTTTGGTTAGAAGGAAGTTGTAATTTCAT[C/T,CTCACAGAGATATTTTGAGTGAGTAGCATATTCCT]
TCACAGCTAGCTTGTGAGGATATTTTGAGTGAGTAGCATATTCCTTTCTTCCTCGAAAAAAAAAACATATCCTCCATGCCCCGAAGTTTTTGTTGTGGTT

Reverse complement sequence

AACCACAACAAAAACTTCGGGGCATGGAGGATATGTTTTTTTTTTCGAGGAAGAAAGGAATATGCTACTCACTCAAAATATCCTCACAAGCTAGCTGTGA[G/A,AGGAATATGCTACTCACTCAAAATATCTCTGTGAG]
ATGAAATTACAACTTCCTTCTAACCAAAAAACCAGAAAGGGAATTAGTTCTCGCCCTATTGGCTAATAGGTGACTAATACCGTTTTGGCTTCTGTGAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 18.90% 0.06% 0.00% CTCACAGAGATATTTTGAGTGAGTAGCATATTCCT: 0.02%
All Indica  2759 97.00% 3.00% 0.00% 0.00% NA
All Japonica  1512 60.80% 39.00% 0.20% 0.00% NA
Aus  269 28.30% 71.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 14.30% 85.30% 0.40% 0.00% NA
Japonica Intermediate  241 51.90% 47.70% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 0.00% 0.00% CTCACAGAGATATTTTGAGTGAGTAGCATATTCCT: 1.04%
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506308814 C -> T LOC_Os05g11180.1 upstream_gene_variant ; 4172.0bp to feature; MODIFIER silent_mutation Average:59.171; most accessible tissue: Callus, score: 92.136 N N N N
vg0506308814 C -> T LOC_Os05g11170.1 downstream_gene_variant ; 2113.0bp to feature; MODIFIER silent_mutation Average:59.171; most accessible tissue: Callus, score: 92.136 N N N N
vg0506308814 C -> T LOC_Os05g11170-LOC_Os05g11180 intergenic_region ; MODIFIER silent_mutation Average:59.171; most accessible tissue: Callus, score: 92.136 N N N N
vg0506308814 C -> CTCACAGAGATATTTTGAGTGAGTAGCATA TTCCT LOC_Os05g11180.1 upstream_gene_variant ; 4171.0bp to feature; MODIFIER silent_mutation Average:59.171; most accessible tissue: Callus, score: 92.136 N N N N
vg0506308814 C -> CTCACAGAGATATTTTGAGTGAGTAGCATA TTCCT LOC_Os05g11170.1 downstream_gene_variant ; 2114.0bp to feature; MODIFIER silent_mutation Average:59.171; most accessible tissue: Callus, score: 92.136 N N N N
vg0506308814 C -> CTCACAGAGATATTTTGAGTGAGTAGCATA TTCCT LOC_Os05g11170-LOC_Os05g11180 intergenic_region ; MODIFIER silent_mutation Average:59.171; most accessible tissue: Callus, score: 92.136 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506308814 NA 8.93E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506308814 NA 6.11E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 8.94E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 3.69E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.33E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 7.93E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.36E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.27E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 4.96E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 8.33E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.57E-13 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 3.30E-09 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 6.89E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 4.53E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.17E-07 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.36E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 3.24E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 5.85E-17 mr1047_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 2.36E-17 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 5.78E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 3.49E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.13E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 5.36E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 3.07E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 8.44E-09 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.31E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 9.60E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.04E-17 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 9.19E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 7.69E-15 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.07E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 3.12E-13 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 9.89E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 2.17E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 5.34E-12 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 4.59E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 7.41E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 1.18E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506308814 NA 4.83E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251