Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506264380:

Variant ID: vg0506264380 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6264380
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, T: 0.10, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGGCAGCCTATTCGACAATGCACAATATAAAAGGTTGATGGATAATATGATTCAGCTTCGCCATGTGGATATGCTACCCGACGATCTAGAAATTGGAT[T/A]
GTGGTGTTTGGTGTGTCTAGAAATTTGATAGTGGTGTGTCTTTGTTTTTCGCTGGTCCATTTGTTCCAAGGTTTTCGGCTATGAGGGTATGTTAGCTCAT

Reverse complement sequence

ATGAGCTAACATACCCTCATAGCCGAAAACCTTGGAACAAATGGACCAGCGAAAAACAAAGACACACCACTATCAAATTTCTAGACACACCAAACACCAC[A/T]
ATCCAATTTCTAGATCGTCGGGTAGCATATCCACATGGCGAAGCTGAATCATATTATCCATCAACCTTTTATATTGTGCATTGTCGAATAGGCTGCCTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 32.70% 0.04% 0.08% NA
All Indica  2759 76.20% 23.80% 0.07% 0.00% NA
All Japonica  1512 58.70% 41.00% 0.00% 0.26% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 49.20% 50.80% 0.00% 0.00% NA
Indica II  465 83.40% 16.10% 0.43% 0.00% NA
Indica III  913 89.60% 10.40% 0.00% 0.00% NA
Indica Intermediate  786 76.60% 23.40% 0.00% 0.00% NA
Temperate Japonica  767 94.00% 5.70% 0.00% 0.26% NA
Tropical Japonica  504 12.30% 87.30% 0.00% 0.40% NA
Japonica Intermediate  241 43.60% 56.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506264380 T -> DEL N N silent_mutation Average:61.956; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0506264380 T -> A LOC_Os05g11130.1 upstream_gene_variant ; 3526.0bp to feature; MODIFIER silent_mutation Average:61.956; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0506264380 T -> A LOC_Os05g11120-LOC_Os05g11130 intergenic_region ; MODIFIER silent_mutation Average:61.956; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506264380 NA 1.21E-13 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506264380 NA 2.14E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506264380 NA 8.36E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 2.85E-11 mr1563 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 1.81E-08 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 3.20E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 1.62E-11 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 4.19E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 1.45E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 3.59E-11 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 2.44E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 7.91E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 3.07E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 8.61E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 2.97E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 4.79E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 1.08E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 1.50E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 1.03E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 4.95E-21 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 5.77E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 2.98E-17 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 2.03E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 3.57E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 2.06E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 9.80E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 1.53E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 1.21E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506264380 NA 3.20E-10 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251