Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506230550:

Variant ID: vg0506230550 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6230550
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTATCAGATGACCGTGTACGTCCTCTCCGCTATCAAACATATTCTCATTCTTGCAATCTGCACATGGACAACACATGTAATCACTGTTTCTTCTTATC[C/T]
GATCCTCCTCCGCGACGTTCATAAAATTTGTTACGCCCTTTCTGTAGTCCGTAGAATGACGTTTCAAATTTTTAGCATACATCCAACTTTAATCAATTGC

Reverse complement sequence

GCAATTGATTAAAGTTGGATGTATGCTAAAAATTTGAAACGTCATTCTACGGACTACAGAAAGGGCGTAACAAATTTTATGAACGTCGCGGAGGAGGATC[G/A]
GATAAGAAGAAACAGTGATTACATGTGTTGTCCATGTGCAGATTGCAAGAATGAGAATATGTTTGATAGCGGAGAGGACGTACACGGTCATCTGATACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	19.40%	0.13%	0.00%	NA
All Indica	2759	96.70%	3.30%	0.04%	0.00%	NA
All Japonica	1512	58.90%	40.70%	0.33%	0.00%	NA
Aus	269	30.90%	69.10%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	94.00%	6.00%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.50%	0.13%	0.00%	NA
Temperate Japonica	767	93.90%	5.90%	0.26%	0.00%	NA
Tropical Japonica	504	13.90%	85.70%	0.40%	0.00%	NA
Japonica Intermediate	241	41.90%	57.70%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506230550	C -> T	LOC_Os05g11080.1	upstream_gene_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:26.566; most accessible tissue: Minghui63 flower, score: 43.559	N	N	N	N
vg0506230550	C -> T	LOC_Os05g11090.1	downstream_gene_variant ; 3269.0bp to feature; MODIFIER	silent_mutation	Average:26.566; most accessible tissue: Minghui63 flower, score: 43.559	N	N	N	N
vg0506230550	C -> T	LOC_Os05g11090.2	downstream_gene_variant ; 3269.0bp to feature; MODIFIER	silent_mutation	Average:26.566; most accessible tissue: Minghui63 flower, score: 43.559	N	N	N	N
vg0506230550	C -> T	LOC_Os05g11080-LOC_Os05g11090	intergenic_region ; MODIFIER	silent_mutation	Average:26.566; most accessible tissue: Minghui63 flower, score: 43.559	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506230550	4.92E-06	NA	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	9.97E-08	NA	mr1114	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	1.10E-06	NA	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	9.40E-06	NA	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	1.82E-07	NA	mr1119	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	1.33E-06	NA	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	1.52E-07	NA	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	2.64E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	4.05E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	1.76E-07	NA	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	5.56E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	1.86E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	1.30E-10	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	6.66E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	1.23E-07	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	9.53E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	3.24E-06	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	4.34E-06	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	1.44E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	1.41E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	2.52E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	2.88E-06	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	4.56E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	2.75E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	5.60E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	9.92E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	4.04E-10	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	1.60E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506230550	NA	8.51E-09	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251