| Variant ID: vg0506207863 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6207863 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGAGCGCAAGCGCCGGGAGAAGCTCAACGATAGCTTCAAGGCTCTCAGGGACGTGCTCCCACCCGCCACCAAGGTCCGTCTACTTACCGACCAATTTAAT[C/A,T]
TAAAAGCTTACGTAAATATAGAATCTCGAGCAAAATCTGTTGTCTTGCTTGACGAAAGATTCTCACATAATCCCAAACTCTCTCAAATCTAGATTGTTAC
GTAACAATCTAGATTTGAGAGAGTTTGGGATTATGTGAGAATCTTTCGTCAAGCAAGACAACAGATTTTGCTCGAGATTCTATATTTACGTAAGCTTTTA[G/T,A]
ATTAAATTGGTCGGTAAGTAGACGGACCTTGGTGGCGGGTGGGAGCACGTCCCTGAGAGCCTTGAAGCTATCGTTGAGCTTCTCCCGGCGCTTGCGCTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 1.90% | 0.53% | 0.00% | A: 0.36% |
| All Indica | 2759 | 99.20% | 0.10% | 0.14% | 0.00% | A: 0.62% |
| All Japonica | 1512 | 92.80% | 5.80% | 1.39% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 0.00% | 0.33% | 0.00% | A: 1.86% |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 81.90% | 14.30% | 3.77% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506207863 | C -> T | LOC_Os05g11070.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.697; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0506207863 | C -> A | LOC_Os05g11070.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.697; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506207863 | 7.25E-06 | 1.68E-07 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506207863 | NA | 5.80E-06 | mr1350 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506207863 | 8.95E-10 | 6.72E-13 | mr1422 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506207863 | 1.78E-07 | 1.56E-12 | mr1583 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506207863 | 2.67E-07 | 5.51E-10 | mr1218_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506207863 | 1.21E-09 | 6.18E-12 | mr1422_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506207863 | 4.89E-07 | 2.79E-09 | mr1583_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506207863 | 2.82E-15 | 4.88E-22 | mr1850_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/