\
| Variant ID: vg0506206267 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 6206267 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.58, C: 0.42, others allele: 0.00, population size: 78. )
GTATACTTTTATGAAAGTATTTTTCAAGACAAATCTATTCATATAATTTTTACATTTTCAAACCCAATAACTTGAGAGTTATTCATGATTTATACTCCCT[T/C]
CGTTTCGAAATGTTTGACGCCGTTGACTTTTTAACACATGTTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTCCTATTATTTG
CAAATAATAGGAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAACATGTGTTAAAAAGTCAACGGCGTCAAACATTTCGAAACG[A/G]
AGGGAGTATAAATCATGAATAACTCTCAAGTTATTGGGTTTGAAAATGTAAAAATTATATGAATAGATTTGTCTTGAAAAATACTTTCATAAAAGTATAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 27.70% | 0.30% | 20.52% | NA |
| All Indica | 2759 | 60.30% | 5.80% | 0.11% | 33.85% | NA |
| All Japonica | 1512 | 40.60% | 56.90% | 0.66% | 1.79% | NA |
| Aus | 269 | 10.80% | 89.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 31.10% | 2.70% | 0.17% | 66.05% | NA |
| Indica II | 465 | 64.10% | 5.80% | 0.00% | 30.11% | NA |
| Indica III | 913 | 79.30% | 4.80% | 0.11% | 15.77% | NA |
| Indica Intermediate | 786 | 58.00% | 9.20% | 0.13% | 32.70% | NA |
| Temperate Japonica | 767 | 64.50% | 33.20% | 1.04% | 1.17% | NA |
| Tropical Japonica | 504 | 9.70% | 87.90% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 29.00% | 67.60% | 0.83% | 2.49% | NA |
| VI/Aromatic | 96 | 82.30% | 16.70% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 55.60% | 34.40% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0506206267 | T -> DEL | N | N | silent_mutation | Average:17.771; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0506206267 | T -> C | LOC_Os05g11070.1 | upstream_gene_variant ; 348.0bp to feature; MODIFIER | silent_mutation | Average:17.771; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0506206267 | T -> C | LOC_Os05g11064-LOC_Os05g11070 | intergenic_region ; MODIFIER | silent_mutation | Average:17.771; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0506206267 | NA | 5.87E-08 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0506206267 | 6.89E-08 | 1.51E-16 | Grain_width | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0506206267 | NA | 1.20E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506206267 | NA | 6.10E-06 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506206267 | NA | 5.95E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506206267 | NA | 2.27E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0506206267 | NA | 5.18E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |