\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506202477:

Variant ID: vg0506202477 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 6202477
Reference Allele: TAlternative Allele: A,TA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.11, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAGAGAGATGAGAGAGAGAGAGAGATAGAGAGAACGACGAATAATGGAAGAGATAGAGGGGTGAGGGGAAGAGAAGTAGGTGGGTCCCACCATTTTTT[T/A,TA]
AAAAAAAATATTGATTAGACTACCACGTGTATACCACGTAGGACGGAAACCACTCTAGATATTGTCAGGGGGTAATTCATCCGGTTTTAAAAAGTTTAGG

Reverse complement sequence

CCTAAACTTTTTAAAACCGGATGAATTACCCCCTGACAATATCTAGAGTGGTTTCCGTCCTACGTGGTATACACGTGGTAGTCTAATCAATATTTTTTTT[A/T,TA]
AAAAAATGGTGGGACCCACCTACTTCTCTTCCCCTCACCCCTCTATCTCTTCCATTATTCGTCGTTCTCTCTATCTCTCTCTCTCTCTCATCTCTCTCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 26.60% 8.68% 27.06% TA: 0.42%
All Indica  2759 26.20% 33.80% 7.47% 32.33% TA: 0.25%
All Japonica  1512 55.70% 17.90% 10.71% 15.67% TA: 0.07%
Aus  269 32.00% 8.20% 5.95% 50.19% TA: 3.72%
Indica I  595 23.00% 5.90% 9.92% 61.18% NA
Indica II  465 41.10% 23.70% 6.67% 28.60% NA
Indica III  913 21.80% 59.70% 3.18% 15.12% TA: 0.22%
Indica Intermediate  786 24.80% 30.80% 11.07% 32.70% TA: 0.64%
Temperate Japonica  767 64.10% 24.50% 7.04% 4.30% NA
Tropical Japonica  504 51.20% 6.20% 14.09% 28.37% TA: 0.20%
Japonica Intermediate  241 38.20% 21.20% 15.35% 25.31% NA
VI/Aromatic  96 82.30% 9.40% 4.17% 2.08% TA: 2.08%
Intermediate  90 33.30% 27.80% 24.44% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506202477 T -> DEL N N silent_mutation Average:57.29; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N
vg0506202477 T -> TA LOC_Os05g11064.1 upstream_gene_variant ; 1618.0bp to feature; MODIFIER silent_mutation Average:57.29; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N
vg0506202477 T -> TA LOC_Os05g11070.1 upstream_gene_variant ; 4137.0bp to feature; MODIFIER silent_mutation Average:57.29; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N
vg0506202477 T -> TA LOC_Os05g11064-LOC_Os05g11070 intergenic_region ; MODIFIER silent_mutation Average:57.29; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N
vg0506202477 T -> A LOC_Os05g11064.1 upstream_gene_variant ; 1617.0bp to feature; MODIFIER silent_mutation Average:57.29; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N
vg0506202477 T -> A LOC_Os05g11070.1 upstream_gene_variant ; 4138.0bp to feature; MODIFIER silent_mutation Average:57.29; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N
vg0506202477 T -> A LOC_Os05g11064-LOC_Os05g11070 intergenic_region ; MODIFIER silent_mutation Average:57.29; most accessible tissue: Minghui63 flag leaf, score: 94.034 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0506202477 T A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg0506202477 T TA -0.09 -0.11 -0.1 -0.02 -0.14 -0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506202477 NA 7.61E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202477 NA 4.39E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202477 4.12E-06 4.12E-06 mr1314_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251