\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506202367:

Variant ID: vg0506202367 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6202367
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGCCACCGTTGCCCCTACTATCCTCCTCGGCGCGGCCCACCGGCCGTGGTGCCCTCCCCGTGACACCGCCGTTCACCGCCGTCTACCACCATCCTCGC[C/T]
GCACACAACGCGAGAGAGATGAGAGAGAGAGAGAGATAGAGAGAACGACGAATAATGGAAGAGATAGAGGGGTGAGGGGAAGAGAAGTAGGTGGGTCCCA

Reverse complement sequence

TGGGACCCACCTACTTCTCTTCCCCTCACCCCTCTATCTCTTCCATTATTCGTCGTTCTCTCTATCTCTCTCTCTCTCTCATCTCTCTCGCGTTGTGTGC[G/A]
GCGAGGATGGTGGTAGACGGCGGTGAACGGCGGTGTCACGGGGAGGGCACCACGGCCGGTGGGCCGCGCCGAGGAGGATAGTAGGGGCAACGGTGGCGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 8.10% 2.98% 27.21% NA
All Indica  2759 64.70% 0.80% 1.78% 32.77% NA
All Japonica  1512 57.20% 22.20% 5.29% 15.28% NA
Aus  269 43.90% 4.80% 1.49% 49.81% NA
Indica I  595 35.00% 0.50% 1.85% 62.69% NA
Indica II  465 64.30% 2.60% 2.58% 30.54% NA
Indica III  913 84.70% 0.00% 0.44% 14.90% NA
Indica Intermediate  786 64.10% 0.90% 2.80% 32.19% NA
Temperate Japonica  767 90.50% 2.50% 1.17% 5.87% NA
Tropical Japonica  504 14.90% 49.60% 9.13% 26.39% NA
Japonica Intermediate  241 39.80% 27.80% 10.37% 21.99% NA
VI/Aromatic  96 91.70% 2.10% 1.04% 5.21% NA
Intermediate  90 70.00% 8.90% 7.78% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506202367 C -> T LOC_Os05g11064.1 upstream_gene_variant ; 1507.0bp to feature; MODIFIER silent_mutation Average:56.941; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N
vg0506202367 C -> T LOC_Os05g11070.1 upstream_gene_variant ; 4248.0bp to feature; MODIFIER silent_mutation Average:56.941; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N
vg0506202367 C -> T LOC_Os05g11064-LOC_Os05g11070 intergenic_region ; MODIFIER silent_mutation Average:56.941; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N
vg0506202367 C -> DEL N N silent_mutation Average:56.941; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0506202367 C T -0.02 -0.03 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506202367 NA 3.30E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 2.33E-06 1.01E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 3.69E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 9.77E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 9.47E-10 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 1.45E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 4.44E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 1.15E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 1.63E-16 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 1.41E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 1.09E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 6.66E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 6.93E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 1.62E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 6.48E-06 6.47E-06 mr1520_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 4.00E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 2.07E-06 3.22E-15 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 4.17E-06 1.01E-20 mr1769_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506202367 NA 4.82E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251