Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506183773:

Variant ID: vg0506183773 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 6183773
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.23, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

TATCAATCACACGAAAAAAACAAAAAGAAGGTGGAGGGCACAGAGATTTTATACTGGTTCGGGCCTCCATGGCGGATAATAGCCCTACATCCAGTTTTTT[C/T]
TCTTTTTTCTCTCTTTCTTCTTCTTTTTTTTTGCCGATGACTGTATGCACATTTTTACAAGTTGGCGATTTGGGTGCCACCCATTCTAGACATAGAAGCG

Reverse complement sequence

CGCTTCTATGTCTAGAATGGGTGGCACCCAAATCGCCAACTTGTAAAAATGTGCATACAGTCATCGGCAAAAAAAAAGAAGAAGAAAGAGAGAAAAAAGA[G/A]
AAAAAACTGGATGTAGGGCTATTATCCGCCATGGAGGCCCGAACCAGTATAAAATCTCTGTGCCCTCCACCTTCTTTTTGTTTTTTTCGTGTGATTGATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.80%	42.30%	2.20%	8.70%	NA
All Indica	2759	37.30%	44.60%	3.52%	14.57%	NA
All Japonica	1512	58.50%	41.10%	0.26%	0.13%	NA
Aus	269	89.20%	10.00%	0.00%	0.74%	NA
Indica I	595	64.00%	28.20%	3.70%	4.03%	NA
Indica II	465	32.30%	52.30%	4.09%	11.40%	NA
Indica III	913	19.90%	52.40%	3.40%	24.32%	NA
Indica Intermediate	786	40.20%	43.50%	3.18%	13.10%	NA
Temperate Japonica	767	33.90%	65.70%	0.26%	0.13%	NA
Tropical Japonica	504	90.10%	9.30%	0.40%	0.20%	NA
Japonica Intermediate	241	70.50%	29.50%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	76.00%	0.00%	3.12%	NA
Intermediate	90	41.10%	53.30%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0506183773	C -> T	LOC_Os05g11030.1	downstream_gene_variant ; 1198.0bp to feature; MODIFIER	silent_mutation	Average:33.062; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0506183773	C -> T	LOC_Os05g11040.1	downstream_gene_variant ; 1268.0bp to feature; MODIFIER	silent_mutation	Average:33.062; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0506183773	C -> T	LOC_Os05g11030-LOC_Os05g11040	intergenic_region ; MODIFIER	silent_mutation	Average:33.062; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0506183773	C -> DEL	N	N	silent_mutation	Average:33.062; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0506183773	NA	4.51E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506183773	NA	5.43E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506183773	NA	2.48E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	7.45E-15	mr1180	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	9.38E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	2.63E-16	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	3.65E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	1.16E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	1.89E-15	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	3.49E-10	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	1.85E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	4.50E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	9.45E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	1.36E-06	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	6.55E-17	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	7.18E-20	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	4.78E-07	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	4.80E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	3.32E-07	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	1.18E-06	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	9.04E-07	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	2.24E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	1.59E-14	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773	NA	2.17E-09	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251