\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506183773:

Variant ID: vg0506183773 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6183773
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.23, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


TATCAATCACACGAAAAAAACAAAAAGAAGGTGGAGGGCACAGAGATTTTATACTGGTTCGGGCCTCCATGGCGGATAATAGCCCTACATCCAGTTTTTT[C/T]
TCTTTTTTCTCTCTTTCTTCTTCTTTTTTTTTGCCGATGACTGTATGCACATTTTTACAAGTTGGCGATTTGGGTGCCACCCATTCTAGACATAGAAGCG

Reverse complement sequence

CGCTTCTATGTCTAGAATGGGTGGCACCCAAATCGCCAACTTGTAAAAATGTGCATACAGTCATCGGCAAAAAAAAAGAAGAAGAAAGAGAGAAAAAAGA[G/A]
AAAAAACTGGATGTAGGGCTATTATCCGCCATGGAGGCCCGAACCAGTATAAAATCTCTGTGCCCTCCACCTTCTTTTTGTTTTTTTCGTGTGATTGATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.80% 42.30% 2.20% 8.70% NA
All Indica  2759 37.30% 44.60% 3.52% 14.57% NA
All Japonica  1512 58.50% 41.10% 0.26% 0.13% NA
Aus  269 89.20% 10.00% 0.00% 0.74% NA
Indica I  595 64.00% 28.20% 3.70% 4.03% NA
Indica II  465 32.30% 52.30% 4.09% 11.40% NA
Indica III  913 19.90% 52.40% 3.40% 24.32% NA
Indica Intermediate  786 40.20% 43.50% 3.18% 13.10% NA
Temperate Japonica  767 33.90% 65.70% 0.26% 0.13% NA
Tropical Japonica  504 90.10% 9.30% 0.40% 0.20% NA
Japonica Intermediate  241 70.50% 29.50% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 76.00% 0.00% 3.12% NA
Intermediate  90 41.10% 53.30% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506183773 C -> T LOC_Os05g11030.1 downstream_gene_variant ; 1198.0bp to feature; MODIFIER silent_mutation Average:33.062; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0506183773 C -> T LOC_Os05g11040.1 downstream_gene_variant ; 1268.0bp to feature; MODIFIER silent_mutation Average:33.062; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0506183773 C -> T LOC_Os05g11030-LOC_Os05g11040 intergenic_region ; MODIFIER silent_mutation Average:33.062; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0506183773 C -> DEL N N silent_mutation Average:33.062; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506183773 NA 4.51E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506183773 NA 5.43E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506183773 NA 2.48E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 7.45E-15 mr1180 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 9.38E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 2.63E-16 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 3.65E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 1.16E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 1.89E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 3.49E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 1.85E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 4.50E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 9.45E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 1.36E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 6.55E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 7.18E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 4.78E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 4.80E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 3.32E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 1.18E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 9.04E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 2.24E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 1.59E-14 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506183773 NA 2.17E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251