\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506159272:

Variant ID: vg0506159272 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 6159272
Reference Allele: AGATATATGAlternative Allele: A
Primary Allele: AGATATATGSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTACTATAGAGTATAGTACTCCTTCAGTTCCATAATATAGGGGAATTTAGAGGGACATGACACATTCTAGAATCATGTATCTGGACATACTGTTGTCT[AGATATATG/A]
GTCTTAAGATGTGTCACATCCCTACAAAATCTCTTATATTATGGGAAGGAGTAATAGGTTAGTTATAAGGTTAGCTCTATTTTTCTCTCACTGTTTCTCT

Reverse complement sequence

AGAGAAACAGTGAGAGAAAAATAGAGCTAACCTTATAACTAACCTATTACTCCTTCCCATAATATAAGAGATTTTGTAGGGATGTGACACATCTTAAGAC[CATATATCT/T]
AGACAACAGTATGTCCAGATACATGATTCTAGAATGTGTCATGTCCCTCTAAATTCCCCTATATTATGGAACTGAAGGAGTACTATACTCTATAGTAGTA

Allele Frequencies:

Populations Population SizeFrequency of AGATATATG(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 42.40% 0.13% 0.30% NA
All Indica  2759 59.60% 39.80% 0.11% 0.47% NA
All Japonica  1512 58.20% 41.60% 0.13% 0.07% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 30.80% 68.60% 0.17% 0.50% NA
Indica II  465 61.30% 37.60% 0.22% 0.86% NA
Indica III  913 79.80% 19.90% 0.00% 0.22% NA
Indica Intermediate  786 57.00% 42.40% 0.13% 0.51% NA
Temperate Japonica  767 93.00% 6.90% 0.13% 0.00% NA
Tropical Japonica  504 13.70% 86.10% 0.20% 0.00% NA
Japonica Intermediate  241 40.70% 58.90% 0.00% 0.41% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506159272 AGATATATG -> DEL N N silent_mutation Average:85.269; most accessible tissue: Callus, score: 93.482 N N N N
vg0506159272 AGATATATG -> A LOC_Os05g11005.1 upstream_gene_variant ; 827.0bp to feature; MODIFIER silent_mutation Average:85.269; most accessible tissue: Callus, score: 93.482 N N N N
vg0506159272 AGATATATG -> A LOC_Os05g11005-LOC_Os05g11010 intergenic_region ; MODIFIER silent_mutation Average:85.269; most accessible tissue: Callus, score: 93.482 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0506159272 AGATA* A -0.12 0.1 0.16 -0.02 -0.09 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506159272 6.58E-07 4.34E-15 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506159272 NA 4.41E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 4.08E-13 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 1.94E-14 mr1093_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 2.35E-08 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 9.41E-13 mr1235_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 5.59E-10 mr1243_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 9.56E-10 mr1248_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 2.78E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 4.49E-11 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 8.85E-06 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 3.64E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 4.42E-11 mr1257_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 6.89E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 4.18E-10 mr1423_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 4.10E-11 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 2.55E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 8.35E-07 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 3.98E-12 mr1599_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 1.85E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 5.04E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 1.75E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 3.24E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 3.56E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 1.13E-09 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 1.26E-06 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506159272 NA 8.97E-11 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251