Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506134837:

Variant ID: vg0506134837 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6134837
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTATTATATGGGTAGGCTGAGAAAATACTATAAGAAACCTTATAGCCAACAGGTCAACTGTATTATTAACCTTGCTCTTAGTACAAATCCAAAAACAG[T/C]
CCATACCCCTGTTTTTACTGGCTTTTGAGGGGAAAAAATTACCGCCTATGCCATTACGGAAAAAAACGATTGGCTGTTTCTTTCGGGACATTTAACTTTG

Reverse complement sequence

CAAAGTTAAATGTCCCGAAAGAAACAGCCAATCGTTTTTTTCCGTAATGGCATAGGCGGTAATTTTTTCCCCTCAAAAGCCAGTAAAAACAGGGGTATGG[A/G]
CTGTTTTTGGATTTGTACTAAGAGCAAGGTTAATAATACAGTTGACCTGTTGGCTATAAGGTTTCTTATAGTATTTTCTCAGCCTACCCATATAATAACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 28.40% 0.34% 0.00% NA
All Indica  2759 95.10% 4.80% 0.04% 0.00% NA
All Japonica  1512 38.30% 60.90% 0.79% 0.00% NA
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 95.60% 4.40% 0.00% 0.00% NA
Indica Intermediate  786 92.00% 7.90% 0.13% 0.00% NA
Temperate Japonica  767 59.30% 39.50% 1.17% 0.00% NA
Tropical Japonica  504 10.10% 89.70% 0.20% 0.00% NA
Japonica Intermediate  241 30.30% 68.90% 0.83% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 65.60% 31.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506134837 T -> C LOC_Os05g10980.1 intron_variant ; MODIFIER silent_mutation Average:66.09; most accessible tissue: Zhenshan97 panicle, score: 91.845 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0506134837 T C 0.02 0.02 0.02 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506134837 NA 1.67E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506134837 NA 7.83E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 1.30E-13 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 8.74E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 3.29E-17 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 9.83E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 1.03E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 6.24E-17 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 5.77E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 9.07E-11 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 1.94E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 1.01E-13 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 1.73E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 9.35E-11 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 7.86E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 4.26E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 7.35E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 1.88E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 9.33E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 9.63E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 6.61E-24 mr1180_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 1.72E-25 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 1.37E-15 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 3.66E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 8.11E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 1.01E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 4.61E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 8.29E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 2.15E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 6.24E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 9.35E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 3.56E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 6.80E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 9.47E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 2.05E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506134837 NA 2.27E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251