\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0506054042:

Variant ID: vg0506054042 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 6054042
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGTCATCAATTCCTCAGTCTTCCAACCTGGATTTTTTTTTACCTTTTATTCCTTTAAACTTATTCTACCAATAGATCCCTTAAAAATATTTATTCTAG[A/G]
AATGATCCCTTTTCGCATCGGCTACGTCATTGGCGTCGTGATCCAATATGACGGCACCAATGACTTTGACGCCATCCCCATTGCCCTTCGGTGGAGCTAA

Reverse complement sequence

TTAGCTCCACCGAAGGGCAATGGGGATGGCGTCAAAGTCATTGGTGCCGTCATATTGGATCACGACGCCAATGACGTAGCCGATGCGAAAAGGGATCATT[T/C]
CTAGAATAAATATTTTTAAGGGATCTATTGGTAGAATAAGTTTAAAGGAATAAAAGGTAAAAAAAAATCCAGGTTGGAAGACTGAGGAATTGATGACGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.10% 23.90% 0.02% 0.00% NA
All Indica  2759 92.60% 7.40% 0.00% 0.00% NA
All Japonica  1512 56.80% 43.10% 0.07% 0.00% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 95.50% 4.50% 0.00% 0.00% NA
Indica Intermediate  786 84.00% 16.00% 0.00% 0.00% NA
Temperate Japonica  767 91.30% 8.70% 0.00% 0.00% NA
Tropical Japonica  504 12.30% 87.50% 0.20% 0.00% NA
Japonica Intermediate  241 40.20% 59.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0506054042 A -> G LOC_Os05g10910.1 downstream_gene_variant ; 3093.0bp to feature; MODIFIER silent_mutation Average:53.786; most accessible tissue: Callus, score: 84.892 N N N N
vg0506054042 A -> G LOC_Os05g10920.1 downstream_gene_variant ; 3323.0bp to feature; MODIFIER silent_mutation Average:53.786; most accessible tissue: Callus, score: 84.892 N N N N
vg0506054042 A -> G LOC_Os05g10910-LOC_Os05g10920 intergenic_region ; MODIFIER silent_mutation Average:53.786; most accessible tissue: Callus, score: 84.892 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0506054042 NA 5.49E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0506054042 NA 3.67E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 1.07E-06 NA mr1113 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 7.49E-06 NA mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 1.74E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 3.59E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 5.12E-08 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 1.58E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 7.15E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 6.85E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 5.61E-13 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 7.83E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 2.03E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 1.48E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 4.81E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 9.07E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 6.36E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 1.72E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0506054042 NA 4.58E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251