\
| Variant ID: vg0505852417 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 5852417 |
| Reference Allele: CG | Alternative Allele: TG,C |
| Primary Allele: CG | Secondary Allele: TG |
Inferred Ancestral Allele: Not determined.
TGCAAGGTTGTGTTTTTATTTATTACAATTTACCTCCTAATAATATAATTAATGCAAGGTCAATTCAGATACGAAATGCCATGAATCCATAGTGATATCA[CG/TG,C]
GGAACCGAATCTCAGCAAAGGAATATGATAAATATAGTCATATCATTAGAATGTAAAAAAAAAACTCTGGTGCATTTGTTTTTTGGCTTCACACATGCTT
AAGCATGTGTGAAGCCAAAAAACAAATGCACCAGAGTTTTTTTTTTACATTCTAATGATATGACTATATTTATCATATTCCTTTGCTGAGATTCGGTTCC[CG/CA,G]
TGATATCACTATGGATTCATGGCATTTCGTATCTGAATTGACCTTGCATTAATTATATTATTAGGAGGTAAATTGTAATAAATAAAAACACAACCTTGCA
| Populations | Population Size | Frequency of CG(primary allele) | Frequency of TG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.50% | 0.00% | 0.00% | C: 0.02% |
| All Indica | 2759 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 59.60% | 40.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.10% | 88.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 0.00% | 0.00% | C: 1.04% |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505852417 | CG -> TG | LOC_Os05g10670.1 | upstream_gene_variant ; 4126.0bp to feature; MODIFIER | silent_mutation | Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0505852417 | CG -> TG | LOC_Os05g10680.1 | upstream_gene_variant ; 3890.0bp to feature; MODIFIER | silent_mutation | Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0505852417 | CG -> TG | LOC_Os05g10670-LOC_Os05g10680 | intergenic_region ; MODIFIER | silent_mutation | Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0505852417 | CG -> C | LOC_Os05g10670.1 | upstream_gene_variant ; 4127.0bp to feature; MODIFIER | silent_mutation | Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0505852417 | CG -> C | LOC_Os05g10680.1 | upstream_gene_variant ; 3889.0bp to feature; MODIFIER | silent_mutation | Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0505852417 | CG -> C | LOC_Os05g10670-LOC_Os05g10680 | intergenic_region ; MODIFIER | silent_mutation | Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505852417 | NA | 3.69E-16 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505852417 | NA | 1.19E-08 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 8.74E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 1.68E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | 1.73E-06 | NA | mr1368 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 7.95E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 7.45E-09 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 1.03E-16 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 5.70E-30 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 9.75E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 7.62E-08 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 2.11E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 1.67E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 8.67E-10 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 2.42E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 4.88E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 1.50E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 1.60E-08 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 5.43E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 2.30E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 3.02E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 6.62E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 6.40E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 2.93E-13 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 3.79E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 2.36E-16 | mr1578_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 3.78E-08 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 4.17E-12 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 3.43E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 5.31E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 3.51E-33 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 3.63E-10 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 3.27E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 1.25E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 8.97E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505852417 | NA | 3.49E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |