Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0505852417:

Variant ID: vg0505852417 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 5852417
Reference Allele: CGAlternative Allele: TG,C
Primary Allele: CGSecondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCAAGGTTGTGTTTTTATTTATTACAATTTACCTCCTAATAATATAATTAATGCAAGGTCAATTCAGATACGAAATGCCATGAATCCATAGTGATATCA[CG/TG,C]
GGAACCGAATCTCAGCAAAGGAATATGATAAATATAGTCATATCATTAGAATGTAAAAAAAAAACTCTGGTGCATTTGTTTTTTGGCTTCACACATGCTT

Reverse complement sequence

AAGCATGTGTGAAGCCAAAAAACAAATGCACCAGAGTTTTTTTTTTACATTCTAATGATATGACTATATTTATCATATTCCTTTGCTGAGATTCGGTTCC[CG/CA,G]
TGATATCACTATGGATTCATGGCATTTCGTATCTGAATTGACCTTGCATTAATTATATTATTAGGAGGTAAATTGTAATAAATAAAAACACAACCTTGCA

Allele Frequencies:

Populations Population SizeFrequency of CG(primary allele) Frequency of TG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 14.50% 0.00% 0.00% C: 0.02%
All Indica  2759 98.20% 1.80% 0.00% 0.00% NA
All Japonica  1512 59.60% 40.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 11.10% 88.90% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 0.00% C: 1.04%
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505852417 CG -> TG LOC_Os05g10670.1 upstream_gene_variant ; 4126.0bp to feature; MODIFIER silent_mutation Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0505852417 CG -> TG LOC_Os05g10680.1 upstream_gene_variant ; 3890.0bp to feature; MODIFIER silent_mutation Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0505852417 CG -> TG LOC_Os05g10670-LOC_Os05g10680 intergenic_region ; MODIFIER silent_mutation Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0505852417 CG -> C LOC_Os05g10670.1 upstream_gene_variant ; 4127.0bp to feature; MODIFIER silent_mutation Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0505852417 CG -> C LOC_Os05g10680.1 upstream_gene_variant ; 3889.0bp to feature; MODIFIER silent_mutation Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0505852417 CG -> C LOC_Os05g10670-LOC_Os05g10680 intergenic_region ; MODIFIER silent_mutation Average:32.79; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505852417 NA 3.69E-16 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505852417 NA 1.19E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 8.74E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 1.68E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 1.73E-06 NA mr1368 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 7.95E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 7.45E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 1.03E-16 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 5.70E-30 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 9.75E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 7.62E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 2.11E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 1.67E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 8.67E-10 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 2.42E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 4.88E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 1.50E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 1.60E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 5.43E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 2.30E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 3.02E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 6.62E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 6.40E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 2.93E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 3.79E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 2.36E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 3.78E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 4.17E-12 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 3.43E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 5.31E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 3.51E-33 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 3.63E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 3.27E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 1.25E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 8.97E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505852417 NA 3.49E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251