\
| Variant ID: vg0505850932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5850932 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCGCGAGCATGGAAAAAGCACAAGACACGGGCGATGTATACAGGTTCGGGCCGCTGAGAAGCGTAATACCCTACTCCTGTGTTTTGGTGGATCTGTGTAT[G/A]
AAGAAGCTACAAAATGCCAGCCAGCCCCCGATCGTTCTCTTCTTTTTCTTCCTAAAAATCCTCCCCCATCTTTCTAAGTGGGCAAGGTCCTCCTTTTATA
TATAAAAGGAGGACCTTGCCCACTTAGAAAGATGGGGGAGGATTTTTAGGAAGAAAAAGAAGAGAACGATCGGGGGCTGGCTGGCATTTTGTAGCTTCTT[C/T]
ATACACAGATCCACCAAAACACAGGAGTAGGGTATTACGCTTCTCAGCGGCCCGAACCTGTATACATCGCCCGTGTCTTGTGCTTTTTCCATGCTCGCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.40% | 9.10% | 4.40% | 58.13% | NA |
| All Indica | 2759 | 20.70% | 5.40% | 2.54% | 71.37% | NA |
| All Japonica | 1512 | 40.70% | 17.70% | 8.00% | 33.60% | NA |
| Aus | 269 | 19.70% | 0.40% | 0.37% | 79.55% | NA |
| Indica I | 595 | 25.40% | 3.70% | 5.38% | 65.55% | NA |
| Indica II | 465 | 7.70% | 3.20% | 1.29% | 87.74% | NA |
| Indica III | 913 | 22.10% | 7.40% | 0.77% | 69.66% | NA |
| Indica Intermediate | 786 | 23.00% | 5.70% | 3.18% | 68.07% | NA |
| Temperate Japonica | 767 | 62.30% | 30.10% | 0.91% | 6.65% | NA |
| Tropical Japonica | 504 | 7.30% | 3.80% | 18.06% | 70.83% | NA |
| Japonica Intermediate | 241 | 41.50% | 7.50% | 9.54% | 41.49% | NA |
| VI/Aromatic | 96 | 82.30% | 1.00% | 6.25% | 10.42% | NA |
| Intermediate | 90 | 28.90% | 8.90% | 11.11% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505850932 | G -> DEL | N | N | silent_mutation | Average:13.365; most accessible tissue: Callus, score: 34.215 | N | N | N | N |
| vg0505850932 | G -> A | LOC_Os05g10670.1 | upstream_gene_variant ; 2641.0bp to feature; MODIFIER | silent_mutation | Average:13.365; most accessible tissue: Callus, score: 34.215 | N | N | N | N |
| vg0505850932 | G -> A | LOC_Os05g10670-LOC_Os05g10680 | intergenic_region ; MODIFIER | silent_mutation | Average:13.365; most accessible tissue: Callus, score: 34.215 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505850932 | NA | 7.07E-09 | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | 2.13E-07 | 2.13E-07 | mr1190 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | 8.93E-08 | 1.47E-07 | mr1245 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | 2.94E-07 | 2.94E-07 | mr1373 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | 8.36E-07 | 8.36E-07 | mr1652 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | 2.42E-07 | 3.09E-08 | mr1697 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | 8.86E-13 | 1.13E-14 | mr1697 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | NA | 3.95E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | NA | 4.06E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | NA | 2.86E-07 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505850932 | NA | 6.12E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |