\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505822309:

Variant ID: vg0505822309 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5822309
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGGAAAGAATGATTGGTCAGCCATGAAACTGTTACCTCATACTTGGTTTCGCATTAAAAGACGTTATGGAGTTTTGAAAAGATTCATGTATGTGCTTC[G/A]
TATGTGTCTAAATTTATATCAACGTTAATGAATCTAAATGAGGGATGAAGAGACCAAAACGTCTTAGAATGTGATAGAATGTGAAACGAAGGGAGTACTA

Reverse complement sequence

TAGTACTCCCTTCGTTTCACATTCTATCACATTCTAAGACGTTTTGGTCTCTTCATCCCTCATTTAGATTCATTAACGTTGATATAAATTTAGACACATA[C/T]
GAAGCACATACATGAATCTTTTCAAAACTCCATAACGTCTTTTAATGCGAAACCAAGTATGAGGTAACAGTTTCATGGCTGACCAATCATTCTTTCCCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.90% 21.30% 0.72% 0.00% NA
All Indica  2759 92.70% 6.90% 0.36% 0.00% NA
All Japonica  1512 46.20% 52.30% 1.52% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 92.60% 6.70% 0.67% 0.00% NA
Indica II  465 96.30% 3.00% 0.65% 0.00% NA
Indica III  913 91.50% 8.50% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.50% 0.38% 0.00% NA
Temperate Japonica  767 11.60% 86.00% 2.35% 0.00% NA
Tropical Japonica  504 92.30% 7.50% 0.20% 0.00% NA
Japonica Intermediate  241 59.80% 38.60% 1.66% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505822309 G -> A LOC_Os05g10650-LOC_Os05g10660 intergenic_region ; MODIFIER silent_mutation Average:74.083; most accessible tissue: Minghui63 panicle, score: 93.63 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0505822309 G A 0.0 0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505822309 NA 2.36E-15 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505822309 7.98E-06 2.83E-10 mr1190 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 2.09E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 4.30E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 4.05E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 1.88E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 1.32E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 7.64E-08 8.13E-09 mr1697 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 5.18E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 1.07E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 6.68E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 4.37E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 1.61E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 9.68E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 5.73E-08 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505822309 NA 6.54E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251