Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505749457:

Variant ID: vg0505749457 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5749457
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGAGGAGTTATTGCTATAAAGTTTACACCACATTGCGCCACGTCATCTTTTTTTCCTGAGCCATTGGATTGTCTGCAGGTCTCCAGATGGACGTTAGAT[C/T]
GACATTGAACAGTATTGGGCCAGCCCATGCTACTCATGGGCCTCTGTTACGTTACACCTTTTTCCAATTGGCCCAGCTATGCCAACCCTATCCACTCCTC

Reverse complement sequence

GAGGAGTGGATAGGGTTGGCATAGCTGGGCCAATTGGAAAAAGGTGTAACGTAACAGAGGCCCATGAGTAGCATGGGCTGGCCCAATACTGTTCAATGTC[G/A]
ATCTAACGTCCATCTGGAGACCTGCAGACAATCCAATGGCTCAGGAAAAAAAGATGACGTGGCGCAATGTGGTGTAAACTTTATAGCAATAACTCCTCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.30%	31.60%	15.07%	16.06%	NA
All Indica	2759	24.90%	52.40%	20.33%	2.36%	NA
All Japonica	1512	60.80%	0.80%	6.22%	32.14%	NA
Aus	269	10.00%	4.50%	15.99%	69.52%	NA
Indica I	595	51.90%	21.00%	26.22%	0.84%	NA
Indica II	465	13.80%	53.80%	26.24%	6.24%	NA
Indica III	913	10.20%	75.60%	13.03%	1.20%	NA
Indica Intermediate	786	28.00%	48.60%	20.87%	2.54%	NA
Temperate Japonica	767	92.80%	0.50%	1.56%	5.08%	NA
Tropical Japonica	504	17.50%	1.20%	13.49%	67.86%	NA
Japonica Intermediate	241	49.80%	0.80%	5.81%	43.57%	NA
VI/Aromatic	96	87.50%	3.10%	1.04%	8.33%	NA
Intermediate	90	50.00%	21.10%	14.44%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505749457	C -> T	LOC_Os05g10570.1	upstream_gene_variant ; 143.0bp to feature; MODIFIER	silent_mutation	Average:37.618; most accessible tissue: Callus, score: 97.659	N	N	N	N
vg0505749457	C -> T	LOC_Os05g10570.2	upstream_gene_variant ; 141.0bp to feature; MODIFIER	silent_mutation	Average:37.618; most accessible tissue: Callus, score: 97.659	N	N	N	N
vg0505749457	C -> T	LOC_Os05g10560.1	downstream_gene_variant ; 1591.0bp to feature; MODIFIER	silent_mutation	Average:37.618; most accessible tissue: Callus, score: 97.659	N	N	N	N
vg0505749457	C -> T	LOC_Os05g10560-LOC_Os05g10570	intergenic_region ; MODIFIER	silent_mutation	Average:37.618; most accessible tissue: Callus, score: 97.659	N	N	N	N
vg0505749457	C -> DEL	N	N	silent_mutation	Average:37.618; most accessible tissue: Callus, score: 97.659	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505749457	NA	3.29E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	6.68E-06	8.44E-06	mr1109_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	7.98E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	4.42E-10	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	2.67E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	4.02E-08	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	1.21E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	9.74E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	3.73E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	1.54E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	6.49E-08	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	1.16E-06	NA	mr1633_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	4.13E-06	NA	mr1665_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	1.55E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	1.58E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	2.54E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	NA	3.98E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457	4.52E-06	NA	mr1976_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251