\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505749457:

Variant ID: vg0505749457 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5749457
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAGGAGTTATTGCTATAAAGTTTACACCACATTGCGCCACGTCATCTTTTTTTCCTGAGCCATTGGATTGTCTGCAGGTCTCCAGATGGACGTTAGAT[C/T]
GACATTGAACAGTATTGGGCCAGCCCATGCTACTCATGGGCCTCTGTTACGTTACACCTTTTTCCAATTGGCCCAGCTATGCCAACCCTATCCACTCCTC

Reverse complement sequence

GAGGAGTGGATAGGGTTGGCATAGCTGGGCCAATTGGAAAAAGGTGTAACGTAACAGAGGCCCATGAGTAGCATGGGCTGGCCCAATACTGTTCAATGTC[G/A]
ATCTAACGTCCATCTGGAGACCTGCAGACAATCCAATGGCTCAGGAAAAAAAGATGACGTGGCGCAATGTGGTGTAAACTTTATAGCAATAACTCCTCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.30% 31.60% 15.07% 16.06% NA
All Indica  2759 24.90% 52.40% 20.33% 2.36% NA
All Japonica  1512 60.80% 0.80% 6.22% 32.14% NA
Aus  269 10.00% 4.50% 15.99% 69.52% NA
Indica I  595 51.90% 21.00% 26.22% 0.84% NA
Indica II  465 13.80% 53.80% 26.24% 6.24% NA
Indica III  913 10.20% 75.60% 13.03% 1.20% NA
Indica Intermediate  786 28.00% 48.60% 20.87% 2.54% NA
Temperate Japonica  767 92.80% 0.50% 1.56% 5.08% NA
Tropical Japonica  504 17.50% 1.20% 13.49% 67.86% NA
Japonica Intermediate  241 49.80% 0.80% 5.81% 43.57% NA
VI/Aromatic  96 87.50% 3.10% 1.04% 8.33% NA
Intermediate  90 50.00% 21.10% 14.44% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505749457 C -> T LOC_Os05g10570.1 upstream_gene_variant ; 143.0bp to feature; MODIFIER silent_mutation Average:37.618; most accessible tissue: Callus, score: 97.659 N N N N
vg0505749457 C -> T LOC_Os05g10570.2 upstream_gene_variant ; 141.0bp to feature; MODIFIER silent_mutation Average:37.618; most accessible tissue: Callus, score: 97.659 N N N N
vg0505749457 C -> T LOC_Os05g10560.1 downstream_gene_variant ; 1591.0bp to feature; MODIFIER silent_mutation Average:37.618; most accessible tissue: Callus, score: 97.659 N N N N
vg0505749457 C -> T LOC_Os05g10560-LOC_Os05g10570 intergenic_region ; MODIFIER silent_mutation Average:37.618; most accessible tissue: Callus, score: 97.659 N N N N
vg0505749457 C -> DEL N N silent_mutation Average:37.618; most accessible tissue: Callus, score: 97.659 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505749457 NA 3.29E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 6.68E-06 8.44E-06 mr1109_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 7.98E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 4.42E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 2.67E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 4.02E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 1.21E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 9.74E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 3.73E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 1.54E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 6.49E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 1.16E-06 NA mr1633_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 4.13E-06 NA mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 1.55E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 1.58E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 2.54E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 NA 3.98E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505749457 4.52E-06 NA mr1976_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251