\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505693786:

Variant ID: vg0505693786 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5693786
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTTCACCAGATGAACAGGGAGATGAACCATTATATCAAAGAAAGACAGTGGGAAAAACATCTTCAGGTGACAGAGGGTATTCACAATATCGGTCTGCA[A/G]
CCCATCTAGATCTTCTGGATCTATAACCTTCTGTCCAATTGCATTGAAGAAGGTGCACAGACGTTGGATCGTGTGACGCACTTTCGATGGTAGAATGCCT

Reverse complement sequence

AGGCATTCTACCATCGAAAGTGCGTCACACGATCCAACGTCTGTGCACCTTCTTCAATGCAATTGGACAGAAGGTTATAGATCCAGAAGATCTAGATGGG[T/C]
TGCAGACCGATATTGTGAATACCCTCTGTCACCTGAAGATGTTTTTCCCACTGTCTTTCTTTGATATAATGGTTCATCTCCCTGTTCATCTGGTGAAGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.30% 0.40% 6.83% 52.52% NA
All Indica  2759 28.80% 0.30% 9.50% 61.36% NA
All Japonica  1512 59.30% 0.50% 2.84% 37.43% NA
Aus  269 30.10% 0.00% 3.35% 66.54% NA
Indica I  595 37.80% 0.50% 5.38% 56.30% NA
Indica II  465 20.60% 0.40% 15.27% 63.66% NA
Indica III  913 24.50% 0.10% 8.98% 66.37% NA
Indica Intermediate  786 31.80% 0.40% 9.80% 58.02% NA
Temperate Japonica  767 92.80% 0.10% 0.78% 6.26% NA
Tropical Japonica  504 12.50% 1.00% 5.56% 80.95% NA
Japonica Intermediate  241 50.20% 0.40% 3.73% 45.64% NA
VI/Aromatic  96 89.60% 1.00% 1.04% 8.33% NA
Intermediate  90 51.10% 0.00% 8.89% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505693786 A -> DEL LOC_Os05g10460.1 N frameshift_variant Average:7.677; most accessible tissue: Callus, score: 17.508 N N N N
vg0505693786 A -> G LOC_Os05g10460.1 synonymous_variant ; p.Leu102Leu; LOW synonymous_codon Average:7.677; most accessible tissue: Callus, score: 17.508 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505693786 NA 4.62E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505693786 NA 3.99E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505693786 NA 1.18E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505693786 2.13E-06 2.55E-08 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505693786 3.49E-07 1.75E-09 mr1498_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251