\
| Variant ID: vg0505693786 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5693786 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGCTTCACCAGATGAACAGGGAGATGAACCATTATATCAAAGAAAGACAGTGGGAAAAACATCTTCAGGTGACAGAGGGTATTCACAATATCGGTCTGCA[A/G]
CCCATCTAGATCTTCTGGATCTATAACCTTCTGTCCAATTGCATTGAAGAAGGTGCACAGACGTTGGATCGTGTGACGCACTTTCGATGGTAGAATGCCT
AGGCATTCTACCATCGAAAGTGCGTCACACGATCCAACGTCTGTGCACCTTCTTCAATGCAATTGGACAGAAGGTTATAGATCCAGAAGATCTAGATGGG[T/C]
TGCAGACCGATATTGTGAATACCCTCTGTCACCTGAAGATGTTTTTCCCACTGTCTTTCTTTGATATAATGGTTCATCTCCCTGTTCATCTGGTGAAGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.30% | 0.40% | 6.83% | 52.52% | NA |
| All Indica | 2759 | 28.80% | 0.30% | 9.50% | 61.36% | NA |
| All Japonica | 1512 | 59.30% | 0.50% | 2.84% | 37.43% | NA |
| Aus | 269 | 30.10% | 0.00% | 3.35% | 66.54% | NA |
| Indica I | 595 | 37.80% | 0.50% | 5.38% | 56.30% | NA |
| Indica II | 465 | 20.60% | 0.40% | 15.27% | 63.66% | NA |
| Indica III | 913 | 24.50% | 0.10% | 8.98% | 66.37% | NA |
| Indica Intermediate | 786 | 31.80% | 0.40% | 9.80% | 58.02% | NA |
| Temperate Japonica | 767 | 92.80% | 0.10% | 0.78% | 6.26% | NA |
| Tropical Japonica | 504 | 12.50% | 1.00% | 5.56% | 80.95% | NA |
| Japonica Intermediate | 241 | 50.20% | 0.40% | 3.73% | 45.64% | NA |
| VI/Aromatic | 96 | 89.60% | 1.00% | 1.04% | 8.33% | NA |
| Intermediate | 90 | 51.10% | 0.00% | 8.89% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505693786 | A -> DEL | LOC_Os05g10460.1 | N | frameshift_variant | Average:7.677; most accessible tissue: Callus, score: 17.508 | N | N | N | N |
| vg0505693786 | A -> G | LOC_Os05g10460.1 | synonymous_variant ; p.Leu102Leu; LOW | synonymous_codon | Average:7.677; most accessible tissue: Callus, score: 17.508 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505693786 | NA | 4.62E-07 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505693786 | NA | 3.99E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505693786 | NA | 1.18E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505693786 | 2.13E-06 | 2.55E-08 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505693786 | 3.49E-07 | 1.75E-09 | mr1498_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |