Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505677328:

Variant ID: vg0505677328 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5677328
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACACACACAAACAAAAATGTCTCCAAAAATCAATATTCGGAAAACTTCAGAAACACATGCAGTCTTTAAAATTGGCCGACGCATATCTGCTGCACTAAA[C/T]
GAATATACATCAGCCCGGAATTGCCATTGATAGAAAGAATCCGAAGCACAAAAATTTTGAGCCCCAAAATCTCATCTATACACCCAGGTCCTGCTCTCCT

Reverse complement sequence

AGGAGAGCAGGACCTGGGTGTATAGATGAGATTTTGGGGCTCAAAATTTTTGTGCTTCGGATTCTTTCTATCAATGGCAATTCCGGGCTGATGTATATTC[G/A]
TTTAGTGCAGCAGATATGCGTCGGCCAATTTTAAAGACTGCATGTGTTTCTGAAGTTTTCCGAATATTGATTTTTGGAGACATTTTTGTTTGTGTGTGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.60%	3.60%	0.19%	4.63%	NA
All Indica	2759	95.00%	3.80%	0.11%	1.09%	NA
All Japonica	1512	99.70%	0.20%	0.00%	0.13%	NA
Aus	269	10.80%	21.60%	1.12%	66.54%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	96.60%	1.50%	0.22%	1.72%	NA
Indica III	913	93.10%	5.60%	0.11%	1.20%	NA
Indica Intermediate	786	92.60%	5.90%	0.13%	1.40%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	93.80%	0.00%	1.04%	5.21%	NA
Intermediate	90	88.90%	5.60%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505677328	C -> T	LOC_Os05g10430.1	upstream_gene_variant ; 2469.0bp to feature; MODIFIER	silent_mutation	Average:36.337; most accessible tissue: Callus, score: 46.721	N	N	N	N
vg0505677328	C -> T	LOC_Os05g10414.1	downstream_gene_variant ; 3286.0bp to feature; MODIFIER	silent_mutation	Average:36.337; most accessible tissue: Callus, score: 46.721	N	N	N	N
vg0505677328	C -> T	LOC_Os05g10420.1	downstream_gene_variant ; 855.0bp to feature; MODIFIER	silent_mutation	Average:36.337; most accessible tissue: Callus, score: 46.721	N	N	N	N
vg0505677328	C -> T	LOC_Os05g10414-LOC_Os05g10420	intergenic_region ; MODIFIER	silent_mutation	Average:36.337; most accessible tissue: Callus, score: 46.721	N	N	N	N
vg0505677328	C -> DEL	N	N	silent_mutation	Average:36.337; most accessible tissue: Callus, score: 46.721	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505677328	6.58E-06	NA	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505677328	2.27E-06	2.27E-06	mr1190	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505677328	3.45E-06	NA	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505677328	2.87E-07	1.18E-06	mr1245	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505677328	2.03E-06	NA	mr1373	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505677328	4.34E-07	4.34E-07	mr1373	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505677328	3.58E-06	NA	mr1652	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505677328	4.73E-06	4.73E-06	mr1652	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505677328	4.49E-14	3.59E-12	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505677328	4.58E-14	2.64E-15	mr1697	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251