\
| Variant ID: vg0505677328 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5677328 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACACACACAAACAAAAATGTCTCCAAAAATCAATATTCGGAAAACTTCAGAAACACATGCAGTCTTTAAAATTGGCCGACGCATATCTGCTGCACTAAA[C/T]
GAATATACATCAGCCCGGAATTGCCATTGATAGAAAGAATCCGAAGCACAAAAATTTTGAGCCCCAAAATCTCATCTATACACCCAGGTCCTGCTCTCCT
AGGAGAGCAGGACCTGGGTGTATAGATGAGATTTTGGGGCTCAAAATTTTTGTGCTTCGGATTCTTTCTATCAATGGCAATTCCGGGCTGATGTATATTC[G/A]
TTTAGTGCAGCAGATATGCGTCGGCCAATTTTAAAGACTGCATGTGTTTCTGAAGTTTTCCGAATATTGATTTTTGGAGACATTTTTGTTTGTGTGTGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 3.60% | 0.19% | 4.63% | NA |
| All Indica | 2759 | 95.00% | 3.80% | 0.11% | 1.09% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.00% | 0.13% | NA |
| Aus | 269 | 10.80% | 21.60% | 1.12% | 66.54% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.60% | 1.50% | 0.22% | 1.72% | NA |
| Indica III | 913 | 93.10% | 5.60% | 0.11% | 1.20% | NA |
| Indica Intermediate | 786 | 92.60% | 5.90% | 0.13% | 1.40% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 88.90% | 5.60% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505677328 | C -> T | LOC_Os05g10430.1 | upstream_gene_variant ; 2469.0bp to feature; MODIFIER | silent_mutation | Average:36.337; most accessible tissue: Callus, score: 46.721 | N | N | N | N |
| vg0505677328 | C -> T | LOC_Os05g10414.1 | downstream_gene_variant ; 3286.0bp to feature; MODIFIER | silent_mutation | Average:36.337; most accessible tissue: Callus, score: 46.721 | N | N | N | N |
| vg0505677328 | C -> T | LOC_Os05g10420.1 | downstream_gene_variant ; 855.0bp to feature; MODIFIER | silent_mutation | Average:36.337; most accessible tissue: Callus, score: 46.721 | N | N | N | N |
| vg0505677328 | C -> T | LOC_Os05g10414-LOC_Os05g10420 | intergenic_region ; MODIFIER | silent_mutation | Average:36.337; most accessible tissue: Callus, score: 46.721 | N | N | N | N |
| vg0505677328 | C -> DEL | N | N | silent_mutation | Average:36.337; most accessible tissue: Callus, score: 46.721 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505677328 | 6.58E-06 | NA | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505677328 | 2.27E-06 | 2.27E-06 | mr1190 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505677328 | 3.45E-06 | NA | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505677328 | 2.87E-07 | 1.18E-06 | mr1245 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505677328 | 2.03E-06 | NA | mr1373 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505677328 | 4.34E-07 | 4.34E-07 | mr1373 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505677328 | 3.58E-06 | NA | mr1652 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505677328 | 4.73E-06 | 4.73E-06 | mr1652 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505677328 | 4.49E-14 | 3.59E-12 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505677328 | 4.58E-14 | 2.64E-15 | mr1697 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |