\
| Variant ID: vg0505673310 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5673310 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )
GAAAATACCTTTATTTTTATATGCGGACCTCTTAAGTGGTCCGTCTGAAAAAAATATGATTTTTGAATTTTTGCAGAAGGTAGCTTATGTGGTCCGCCTG[C/T]
AAAAATCATACCTACATAAAATAAACTAAGTCCCCTATCATATCTTCTCTTCCATCTTATCCTCTCCCCACCACTCATTCCCCTCCCCCTCTCTCTCTCT
AGAGAGAGAGAGGGGGAGGGGAATGAGTGGTGGGGAGAGGATAAGATGGAAGAGAAGATATGATAGGGGACTTAGTTTATTTTATGTAGGTATGATTTTT[G/A]
CAGGCGGACCACATAAGCTACCTTCTGCAAAAATTCAAAAATCATATTTTTTTCAGACGGACCACTTAAGAGGTCCGCATATAAAAATAAAGGTATTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.50% | 11.30% | 1.31% | 48.92% | NA |
| All Indica | 2759 | 19.40% | 18.60% | 1.63% | 60.42% | NA |
| All Japonica | 1512 | 58.50% | 0.60% | 0.99% | 39.95% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.20% | 11.90% | 1.68% | 63.19% | NA |
| Indica II | 465 | 13.10% | 17.80% | 2.15% | 66.88% | NA |
| Indica III | 913 | 15.60% | 26.40% | 1.31% | 56.74% | NA |
| Indica Intermediate | 786 | 24.60% | 15.00% | 1.65% | 58.78% | NA |
| Temperate Japonica | 767 | 92.60% | 0.90% | 0.00% | 6.52% | NA |
| Tropical Japonica | 504 | 10.70% | 0.20% | 2.98% | 86.11% | NA |
| Japonica Intermediate | 241 | 49.80% | 0.40% | 0.00% | 49.79% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 48.90% | 10.00% | 1.11% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505673310 | C -> T | LOC_Os05g10414.1 | upstream_gene_variant ; 99.0bp to feature; MODIFIER | silent_mutation | Average:43.307; most accessible tissue: Callus, score: 96.507 | N | N | N | N |
| vg0505673310 | C -> T | LOC_Os05g10400.1 | downstream_gene_variant ; 4441.0bp to feature; MODIFIER | silent_mutation | Average:43.307; most accessible tissue: Callus, score: 96.507 | N | N | N | N |
| vg0505673310 | C -> T | LOC_Os05g10420.1 | downstream_gene_variant ; 4873.0bp to feature; MODIFIER | silent_mutation | Average:43.307; most accessible tissue: Callus, score: 96.507 | N | N | N | N |
| vg0505673310 | C -> T | LOC_Os05g10400-LOC_Os05g10414 | intergenic_region ; MODIFIER | silent_mutation | Average:43.307; most accessible tissue: Callus, score: 96.507 | N | N | N | N |
| vg0505673310 | C -> DEL | N | N | silent_mutation | Average:43.307; most accessible tissue: Callus, score: 96.507 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505673310 | NA | 1.18E-15 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505673310 | NA | 3.70E-07 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | NA | 8.98E-16 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | NA | 1.76E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | 4.74E-06 | NA | mr1697 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | NA | 8.69E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | NA | 4.52E-08 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | NA | 4.65E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | NA | 1.39E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | NA | 1.15E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | NA | 6.35E-06 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505673310 | NA | 1.30E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |