\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505673310:

Variant ID: vg0505673310 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5673310
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAATACCTTTATTTTTATATGCGGACCTCTTAAGTGGTCCGTCTGAAAAAAATATGATTTTTGAATTTTTGCAGAAGGTAGCTTATGTGGTCCGCCTG[C/T]
AAAAATCATACCTACATAAAATAAACTAAGTCCCCTATCATATCTTCTCTTCCATCTTATCCTCTCCCCACCACTCATTCCCCTCCCCCTCTCTCTCTCT

Reverse complement sequence

AGAGAGAGAGAGGGGGAGGGGAATGAGTGGTGGGGAGAGGATAAGATGGAAGAGAAGATATGATAGGGGACTTAGTTTATTTTATGTAGGTATGATTTTT[G/A]
CAGGCGGACCACATAAGCTACCTTCTGCAAAAATTCAAAAATCATATTTTTTTCAGACGGACCACTTAAGAGGTCCGCATATAAAAATAAAGGTATTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 11.30% 1.31% 48.92% NA
All Indica  2759 19.40% 18.60% 1.63% 60.42% NA
All Japonica  1512 58.50% 0.60% 0.99% 39.95% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 23.20% 11.90% 1.68% 63.19% NA
Indica II  465 13.10% 17.80% 2.15% 66.88% NA
Indica III  913 15.60% 26.40% 1.31% 56.74% NA
Indica Intermediate  786 24.60% 15.00% 1.65% 58.78% NA
Temperate Japonica  767 92.60% 0.90% 0.00% 6.52% NA
Tropical Japonica  504 10.70% 0.20% 2.98% 86.11% NA
Japonica Intermediate  241 49.80% 0.40% 0.00% 49.79% NA
VI/Aromatic  96 92.70% 1.00% 1.04% 5.21% NA
Intermediate  90 48.90% 10.00% 1.11% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505673310 C -> T LOC_Os05g10414.1 upstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:43.307; most accessible tissue: Callus, score: 96.507 N N N N
vg0505673310 C -> T LOC_Os05g10400.1 downstream_gene_variant ; 4441.0bp to feature; MODIFIER silent_mutation Average:43.307; most accessible tissue: Callus, score: 96.507 N N N N
vg0505673310 C -> T LOC_Os05g10420.1 downstream_gene_variant ; 4873.0bp to feature; MODIFIER silent_mutation Average:43.307; most accessible tissue: Callus, score: 96.507 N N N N
vg0505673310 C -> T LOC_Os05g10400-LOC_Os05g10414 intergenic_region ; MODIFIER silent_mutation Average:43.307; most accessible tissue: Callus, score: 96.507 N N N N
vg0505673310 C -> DEL N N silent_mutation Average:43.307; most accessible tissue: Callus, score: 96.507 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505673310 NA 1.18E-15 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505673310 NA 3.70E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 NA 8.98E-16 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 NA 1.76E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 4.74E-06 NA mr1697 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 NA 8.69E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 NA 4.52E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 NA 4.65E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 NA 1.39E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 NA 1.15E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 NA 6.35E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505673310 NA 1.30E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251