Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505638872:

Variant ID: vg0505638872 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5638872
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTTGCAATTTTCCTTAATTATTAGACAAAGGTATGCACGACAAGCTTGCTCAATGGTACATTGCTAGATAGATTTACTGCTCCTACACGTACGTGCT[A/G]
TTATAAATCTCATCAACCTCATAAGGAAAAGTACAGATAGGCACGCGCCAAAAATTATTGTAACTTAGAAGCATTTCAAGACAAAACAAGATGAAACGCA

Reverse complement sequence

TGCGTTTCATCTTGTTTTGTCTTGAAATGCTTCTAAGTTACAATAATTTTTGGCGCGTGCCTATCTGTACTTTTCCTTATGAGGTTGATGAGATTTATAA[T/C]
AGCACGTACGTGTAGGAGCAGTAAATCTATCTAGCAATGTACCATTGAGCAAGCTTGTCGTGCATACCTTTGTCTAATAATTAAGGAAAATTGCAAAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.70%	15.10%	1.44%	64.68%	NA
All Indica	2759	13.30%	6.60%	0.94%	79.16%	NA
All Japonica	1512	27.40%	28.80%	2.51%	41.27%	NA
Aus	269	7.80%	21.90%	0.00%	70.26%	NA
Indica I	595	21.30%	6.60%	1.34%	70.76%	NA
Indica II	465	9.50%	2.40%	1.72%	86.45%	NA
Indica III	913	8.30%	6.40%	0.33%	84.99%	NA
Indica Intermediate	786	15.10%	9.50%	0.89%	74.43%	NA
Temperate Japonica	767	40.90%	47.60%	4.17%	7.30%	NA
Tropical Japonica	504	5.00%	5.80%	0.40%	88.89%	NA
Japonica Intermediate	241	31.50%	17.00%	1.66%	49.79%	NA
VI/Aromatic	96	74.00%	13.50%	0.00%	12.50%	NA
Intermediate	90	14.40%	27.80%	4.44%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505638872	A -> DEL	N	N	silent_mutation	Average:6.861; most accessible tissue: Callus, score: 22.417	N	N	N	N
vg0505638872	A -> G	LOC_Os05g10320.1	downstream_gene_variant ; 2736.0bp to feature; MODIFIER	silent_mutation	Average:6.861; most accessible tissue: Callus, score: 22.417	N	N	N	N
vg0505638872	A -> G	LOC_Os05g10330.1	intron_variant ; MODIFIER	silent_mutation	Average:6.861; most accessible tissue: Callus, score: 22.417	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505638872	NA	2.79E-15	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505638872	NA	4.22E-06	mr1263	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505638872	NA	4.22E-06	mr1451	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505638872	1.16E-09	7.62E-12	mr1697	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505638872	NA	7.95E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505638872	NA	8.60E-06	mr1528_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505638872	NA	6.17E-09	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251