Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505638334:

Variant ID: vg0505638334 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5638334
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGAATCATAAACTAAGGATGATATATATTTGGTGTGATATTTTGCAATTTTCCTTAATTATTAGACAAAGGTACGCACGACAAGCTTGCTCAATGGTA[T/C]
ATTGCTAGATAGATTTACTGCTCCTACACGTACGTGCTATTATAAATCTCATCAACCTCATAAGGAAAAGTACAGATAGGCACGCGCCGAAAATTATTGT

Reverse complement sequence

ACAATAATTTTCGGCGCGTGCCTATCTGTACTTTTCCTTATGAGGTTGATGAGATTTATAATAGCACGTACGTGTAGGAGCAGTAAATCTATCTAGCAAT[A/G]
TACCATTGAGCAAGCTTGTCGTGCGTACCTTTGTCTAATAATTAAGGAAAATTGCAAAATATCACACCAAATATATATCATCCTTAGTTTATGATTCACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.40%	4.00%	0.72%	63.86%	NA
All Indica	2759	17.00%	4.10%	0.69%	78.22%	NA
All Japonica	1512	57.90%	0.60%	0.99%	40.48%	NA
Aus	269	8.60%	21.60%	0.00%	69.89%	NA
Indica I	595	29.20%	0.20%	0.84%	69.75%	NA
Indica II	465	11.60%	1.70%	0.43%	86.24%	NA
Indica III	913	10.10%	5.80%	0.33%	83.79%	NA
Indica Intermediate	786	19.10%	6.40%	1.15%	73.41%	NA
Temperate Japonica	767	90.60%	0.80%	1.30%	7.30%	NA
Tropical Japonica	504	11.30%	0.60%	0.99%	87.10%	NA
Japonica Intermediate	241	51.50%	0.00%	0.00%	48.55%	NA
VI/Aromatic	96	86.50%	0.00%	0.00%	13.54%	NA
Intermediate	90	35.60%	12.20%	0.00%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505638334	T -> DEL	N	N	silent_mutation	Average:7.247; most accessible tissue: Callus, score: 20.515	N	N	N	N
vg0505638334	T -> C	LOC_Os05g10320.1	downstream_gene_variant ; 2198.0bp to feature; MODIFIER	silent_mutation	Average:7.247; most accessible tissue: Callus, score: 20.515	N	N	N	N
vg0505638334	T -> C	LOC_Os05g10330.1	downstream_gene_variant ; 188.0bp to feature; MODIFIER	silent_mutation	Average:7.247; most accessible tissue: Callus, score: 20.515	N	N	N	N
vg0505638334	T -> C	LOC_Os05g10320-LOC_Os05g10330	intergenic_region ; MODIFIER	silent_mutation	Average:7.247; most accessible tissue: Callus, score: 20.515	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505638334	6.86E-06	NA	mr1245	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505638334	7.04E-06	7.04E-06	mr1373	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505638334	1.74E-09	1.70E-08	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505638334	9.02E-13	7.68E-14	mr1697	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505638334	4.90E-06	NA	mr1528_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251