\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505634624:

Variant ID: vg0505634624 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5634624
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TCCATCGTCATCTTCATAATAGTATGACCTGCACTCAAATCCAGATTCTAGCTCGAATTATTAAATAACCCTGCTAGCTATCATCCGTAGTAATCTGGCC[G/A]
ATCACATTCATCACATGGCCAAATTACACAATAAACATACACCACTTGCAAGGGGGATTTAATCAAAATATTTTCAAAGAGCCAATAATTCCGCGAGCTA

Reverse complement sequence

TAGCTCGCGGAATTATTGGCTCTTTGAAAATATTTTGATTAAATCCCCCTTGCAAGTGGTGTATGTTTATTGTGTAATTTGGCCATGTGATGAATGTGAT[C/T]
GGCCAGATTACTACGGATGATAGCTAGCAGGGTTATTTAATAATTCGAGCTAGAATCTGGATTTGAGTGCAGGTCATACTATTATGAAGATGACGATGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.60% 5.10% 1.04% 62.25% NA
All Indica  2759 17.30% 4.50% 0.98% 77.20% NA
All Japonica  1512 58.60% 0.30% 0.40% 40.74% NA
Aus  269 8.60% 34.90% 5.20% 51.30% NA
Indica I  595 29.60% 0.20% 0.84% 69.41% NA
Indica II  465 12.30% 1.50% 0.86% 85.38% NA
Indica III  913 9.70% 6.60% 0.99% 82.69% NA
Indica Intermediate  786 19.70% 7.30% 1.15% 71.88% NA
Temperate Japonica  767 92.60% 0.00% 0.00% 7.43% NA
Tropical Japonica  504 10.90% 0.60% 0.99% 87.50% NA
Japonica Intermediate  241 50.20% 0.40% 0.41% 48.96% NA
VI/Aromatic  96 79.20% 8.30% 0.00% 12.50% NA
Intermediate  90 34.40% 12.20% 2.22% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505634624 G -> DEL N N silent_mutation Average:15.274; most accessible tissue: Callus, score: 87.084 N N N N
vg0505634624 G -> A LOC_Os05g10310.1 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 87.084 N N N N
vg0505634624 G -> A LOC_Os05g10320.1 upstream_gene_variant ; 1240.0bp to feature; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 87.084 N N N N
vg0505634624 G -> A LOC_Os05g10310.3 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 87.084 N N N N
vg0505634624 G -> A LOC_Os05g10310.2 upstream_gene_variant ; 1718.0bp to feature; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 87.084 N N N N
vg0505634624 G -> A LOC_Os05g10330.1 downstream_gene_variant ; 3898.0bp to feature; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 87.084 N N N N
vg0505634624 G -> A LOC_Os05g10310-LOC_Os05g10320 intergenic_region ; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 87.084 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505634624 NA 1.34E-06 mr1265 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624 3.71E-07 1.43E-07 mr1528 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624 NA 4.50E-06 mr1528 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624 5.31E-06 NA mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624 3.75E-12 6.87E-10 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505634624 2.45E-11 2.12E-12 mr1697 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251