\
| Variant ID: vg0505634624 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5634624 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 186. )
TCCATCGTCATCTTCATAATAGTATGACCTGCACTCAAATCCAGATTCTAGCTCGAATTATTAAATAACCCTGCTAGCTATCATCCGTAGTAATCTGGCC[G/A]
ATCACATTCATCACATGGCCAAATTACACAATAAACATACACCACTTGCAAGGGGGATTTAATCAAAATATTTTCAAAGAGCCAATAATTCCGCGAGCTA
TAGCTCGCGGAATTATTGGCTCTTTGAAAATATTTTGATTAAATCCCCCTTGCAAGTGGTGTATGTTTATTGTGTAATTTGGCCATGTGATGAATGTGAT[C/T]
GGCCAGATTACTACGGATGATAGCTAGCAGGGTTATTTAATAATTCGAGCTAGAATCTGGATTTGAGTGCAGGTCATACTATTATGAAGATGACGATGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.60% | 5.10% | 1.04% | 62.25% | NA |
| All Indica | 2759 | 17.30% | 4.50% | 0.98% | 77.20% | NA |
| All Japonica | 1512 | 58.60% | 0.30% | 0.40% | 40.74% | NA |
| Aus | 269 | 8.60% | 34.90% | 5.20% | 51.30% | NA |
| Indica I | 595 | 29.60% | 0.20% | 0.84% | 69.41% | NA |
| Indica II | 465 | 12.30% | 1.50% | 0.86% | 85.38% | NA |
| Indica III | 913 | 9.70% | 6.60% | 0.99% | 82.69% | NA |
| Indica Intermediate | 786 | 19.70% | 7.30% | 1.15% | 71.88% | NA |
| Temperate Japonica | 767 | 92.60% | 0.00% | 0.00% | 7.43% | NA |
| Tropical Japonica | 504 | 10.90% | 0.60% | 0.99% | 87.50% | NA |
| Japonica Intermediate | 241 | 50.20% | 0.40% | 0.41% | 48.96% | NA |
| VI/Aromatic | 96 | 79.20% | 8.30% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 34.40% | 12.20% | 2.22% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505634624 | G -> DEL | N | N | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 87.084 | N | N | N | N |
| vg0505634624 | G -> A | LOC_Os05g10310.1 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 87.084 | N | N | N | N |
| vg0505634624 | G -> A | LOC_Os05g10320.1 | upstream_gene_variant ; 1240.0bp to feature; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 87.084 | N | N | N | N |
| vg0505634624 | G -> A | LOC_Os05g10310.3 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 87.084 | N | N | N | N |
| vg0505634624 | G -> A | LOC_Os05g10310.2 | upstream_gene_variant ; 1718.0bp to feature; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 87.084 | N | N | N | N |
| vg0505634624 | G -> A | LOC_Os05g10330.1 | downstream_gene_variant ; 3898.0bp to feature; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 87.084 | N | N | N | N |
| vg0505634624 | G -> A | LOC_Os05g10310-LOC_Os05g10320 | intergenic_region ; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 87.084 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505634624 | NA | 1.34E-06 | mr1265 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505634624 | 3.71E-07 | 1.43E-07 | mr1528 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505634624 | NA | 4.50E-06 | mr1528 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505634624 | 5.31E-06 | NA | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505634624 | 3.75E-12 | 6.87E-10 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505634624 | 2.45E-11 | 2.12E-12 | mr1697 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |