\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505633780:

Variant ID: vg0505633780 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5633780
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCATCAAGGAGATAGCACTATACACTGTTGGCGCTTTTTTAGGCCAACACAAGATCACCTAACGATTTACGGTATAATCAACAGAGTTGCCAAAATCG[T/A]
TAGATCAAAACTAGCTAGCAAAGCCGATTTCAAGATTAATTCACTTTCACGGAATCAAGCGACTAATTTACAAGCAAATTAGCAAAGAGGATAAATATCG

Reverse complement sequence

CGATATTTATCCTCTTTGCTAATTTGCTTGTAAATTAGTCGCTTGATTCCGTGAAAGTGAATTAATCTTGAAATCGGCTTTGCTAGCTAGTTTTGATCTA[A/T]
CGATTTTGGCAACTCTGTTGATTATACCGTAAATCGTTAGGTGATCTTGTGTTGGCCTAAAAAAGCGCCAACAGTGTATAGTGCTATCTCCTTGATGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.50% 4.10% 0.68% 63.71% NA
All Indica  2759 17.10% 4.10% 0.98% 77.82% NA
All Japonica  1512 58.90% 0.30% 0.26% 40.61% NA
Aus  269 8.20% 21.60% 0.00% 70.26% NA
Indica I  595 29.40% 0.20% 1.68% 68.74% NA
Indica II  465 12.70% 1.70% 0.43% 85.16% NA
Indica III  913 9.90% 5.90% 0.44% 83.79% NA
Indica Intermediate  786 18.70% 6.50% 1.40% 73.41% NA
Temperate Japonica  767 92.80% 0.00% 0.13% 7.04% NA
Tropical Japonica  504 10.90% 0.60% 0.40% 88.10% NA
Japonica Intermediate  241 51.00% 0.40% 0.41% 48.13% NA
VI/Aromatic  96 79.20% 7.30% 0.00% 13.54% NA
Intermediate  90 34.40% 11.10% 1.11% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505633780 T -> DEL N N silent_mutation Average:14.674; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633780 T -> A LOC_Os05g10310.1 upstream_gene_variant ; 874.0bp to feature; MODIFIER silent_mutation Average:14.674; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633780 T -> A LOC_Os05g10320.1 upstream_gene_variant ; 2084.0bp to feature; MODIFIER silent_mutation Average:14.674; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633780 T -> A LOC_Os05g10310.3 upstream_gene_variant ; 874.0bp to feature; MODIFIER silent_mutation Average:14.674; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633780 T -> A LOC_Os05g10310.2 upstream_gene_variant ; 874.0bp to feature; MODIFIER silent_mutation Average:14.674; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633780 T -> A LOC_Os05g10330.1 downstream_gene_variant ; 4742.0bp to feature; MODIFIER silent_mutation Average:14.674; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633780 T -> A LOC_Os05g10310-LOC_Os05g10320 intergenic_region ; MODIFIER silent_mutation Average:14.674; most accessible tissue: Callus, score: 62.814 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505633780 2.81E-06 2.81E-06 mr1190 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505633780 2.88E-06 2.88E-06 mr1373 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505633780 6.34E-12 3.44E-09 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505633780 5.39E-12 6.60E-12 mr1697 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251