Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505633780:

Variant ID: vg0505633780 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5633780
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGCATCAAGGAGATAGCACTATACACTGTTGGCGCTTTTTTAGGCCAACACAAGATCACCTAACGATTTACGGTATAATCAACAGAGTTGCCAAAATCG[T/A]
TAGATCAAAACTAGCTAGCAAAGCCGATTTCAAGATTAATTCACTTTCACGGAATCAAGCGACTAATTTACAAGCAAATTAGCAAAGAGGATAAATATCG

Reverse complement sequence

CGATATTTATCCTCTTTGCTAATTTGCTTGTAAATTAGTCGCTTGATTCCGTGAAAGTGAATTAATCTTGAAATCGGCTTTGCTAGCTAGTTTTGATCTA[A/T]
CGATTTTGGCAACTCTGTTGATTATACCGTAAATCGTTAGGTGATCTTGTGTTGGCCTAAAAAAGCGCCAACAGTGTATAGTGCTATCTCCTTGATGCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.50%	4.10%	0.68%	63.71%	NA
All Indica	2759	17.10%	4.10%	0.98%	77.82%	NA
All Japonica	1512	58.90%	0.30%	0.26%	40.61%	NA
Aus	269	8.20%	21.60%	0.00%	70.26%	NA
Indica I	595	29.40%	0.20%	1.68%	68.74%	NA
Indica II	465	12.70%	1.70%	0.43%	85.16%	NA
Indica III	913	9.90%	5.90%	0.44%	83.79%	NA
Indica Intermediate	786	18.70%	6.50%	1.40%	73.41%	NA
Temperate Japonica	767	92.80%	0.00%	0.13%	7.04%	NA
Tropical Japonica	504	10.90%	0.60%	0.40%	88.10%	NA
Japonica Intermediate	241	51.00%	0.40%	0.41%	48.13%	NA
VI/Aromatic	96	79.20%	7.30%	0.00%	13.54%	NA
Intermediate	90	34.40%	11.10%	1.11%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505633780	T -> DEL	N	N	silent_mutation	Average:14.674; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633780	T -> A	LOC_Os05g10310.1	upstream_gene_variant ; 874.0bp to feature; MODIFIER	silent_mutation	Average:14.674; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633780	T -> A	LOC_Os05g10320.1	upstream_gene_variant ; 2084.0bp to feature; MODIFIER	silent_mutation	Average:14.674; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633780	T -> A	LOC_Os05g10310.3	upstream_gene_variant ; 874.0bp to feature; MODIFIER	silent_mutation	Average:14.674; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633780	T -> A	LOC_Os05g10310.2	upstream_gene_variant ; 874.0bp to feature; MODIFIER	silent_mutation	Average:14.674; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633780	T -> A	LOC_Os05g10330.1	downstream_gene_variant ; 4742.0bp to feature; MODIFIER	silent_mutation	Average:14.674; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633780	T -> A	LOC_Os05g10310-LOC_Os05g10320	intergenic_region ; MODIFIER	silent_mutation	Average:14.674; most accessible tissue: Callus, score: 62.814	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505633780	2.81E-06	2.81E-06	mr1190	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505633780	2.88E-06	2.88E-06	mr1373	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505633780	6.34E-12	3.44E-09	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505633780	5.39E-12	6.60E-12	mr1697	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251