\
| Variant ID: vg0505633780 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5633780 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGCATCAAGGAGATAGCACTATACACTGTTGGCGCTTTTTTAGGCCAACACAAGATCACCTAACGATTTACGGTATAATCAACAGAGTTGCCAAAATCG[T/A]
TAGATCAAAACTAGCTAGCAAAGCCGATTTCAAGATTAATTCACTTTCACGGAATCAAGCGACTAATTTACAAGCAAATTAGCAAAGAGGATAAATATCG
CGATATTTATCCTCTTTGCTAATTTGCTTGTAAATTAGTCGCTTGATTCCGTGAAAGTGAATTAATCTTGAAATCGGCTTTGCTAGCTAGTTTTGATCTA[A/T]
CGATTTTGGCAACTCTGTTGATTATACCGTAAATCGTTAGGTGATCTTGTGTTGGCCTAAAAAAGCGCCAACAGTGTATAGTGCTATCTCCTTGATGCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.50% | 4.10% | 0.68% | 63.71% | NA |
| All Indica | 2759 | 17.10% | 4.10% | 0.98% | 77.82% | NA |
| All Japonica | 1512 | 58.90% | 0.30% | 0.26% | 40.61% | NA |
| Aus | 269 | 8.20% | 21.60% | 0.00% | 70.26% | NA |
| Indica I | 595 | 29.40% | 0.20% | 1.68% | 68.74% | NA |
| Indica II | 465 | 12.70% | 1.70% | 0.43% | 85.16% | NA |
| Indica III | 913 | 9.90% | 5.90% | 0.44% | 83.79% | NA |
| Indica Intermediate | 786 | 18.70% | 6.50% | 1.40% | 73.41% | NA |
| Temperate Japonica | 767 | 92.80% | 0.00% | 0.13% | 7.04% | NA |
| Tropical Japonica | 504 | 10.90% | 0.60% | 0.40% | 88.10% | NA |
| Japonica Intermediate | 241 | 51.00% | 0.40% | 0.41% | 48.13% | NA |
| VI/Aromatic | 96 | 79.20% | 7.30% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 34.40% | 11.10% | 1.11% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505633780 | T -> DEL | N | N | silent_mutation | Average:14.674; most accessible tissue: Callus, score: 62.814 | N | N | N | N |
| vg0505633780 | T -> A | LOC_Os05g10310.1 | upstream_gene_variant ; 874.0bp to feature; MODIFIER | silent_mutation | Average:14.674; most accessible tissue: Callus, score: 62.814 | N | N | N | N |
| vg0505633780 | T -> A | LOC_Os05g10320.1 | upstream_gene_variant ; 2084.0bp to feature; MODIFIER | silent_mutation | Average:14.674; most accessible tissue: Callus, score: 62.814 | N | N | N | N |
| vg0505633780 | T -> A | LOC_Os05g10310.3 | upstream_gene_variant ; 874.0bp to feature; MODIFIER | silent_mutation | Average:14.674; most accessible tissue: Callus, score: 62.814 | N | N | N | N |
| vg0505633780 | T -> A | LOC_Os05g10310.2 | upstream_gene_variant ; 874.0bp to feature; MODIFIER | silent_mutation | Average:14.674; most accessible tissue: Callus, score: 62.814 | N | N | N | N |
| vg0505633780 | T -> A | LOC_Os05g10330.1 | downstream_gene_variant ; 4742.0bp to feature; MODIFIER | silent_mutation | Average:14.674; most accessible tissue: Callus, score: 62.814 | N | N | N | N |
| vg0505633780 | T -> A | LOC_Os05g10310-LOC_Os05g10320 | intergenic_region ; MODIFIER | silent_mutation | Average:14.674; most accessible tissue: Callus, score: 62.814 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505633780 | 2.81E-06 | 2.81E-06 | mr1190 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505633780 | 2.88E-06 | 2.88E-06 | mr1373 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505633780 | 6.34E-12 | 3.44E-09 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505633780 | 5.39E-12 | 6.60E-12 | mr1697 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |