\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505633755:

Variant ID: vg0505633755 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5633755
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACCGTATTCCCTAGCTTGCACCTTTGCATCAAGGAGATAGCACTATACACTGTTGGCGCTTTTTTAGGCCAACACAAGATCACCTAACGATTTACGGT[A/G]
TAATCAACAGAGTTGCCAAAATCGTTAGATCAAAACTAGCTAGCAAAGCCGATTTCAAGATTAATTCACTTTCACGGAATCAAGCGACTAATTTACAAGC

Reverse complement sequence

GCTTGTAAATTAGTCGCTTGATTCCGTGAAAGTGAATTAATCTTGAAATCGGCTTTGCTAGCTAGTTTTGATCTAACGATTTTGGCAACTCTGTTGATTA[T/C]
ACCGTAAATCGTTAGGTGATCTTGTGTTGGCCTAAAAAAGCGCCAACAGTGTATAGTGCTATCTCCTTGATGCAAAGGTGCAAGCTAGGGAATACGGTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.50% 4.10% 0.68% 63.73% NA
All Indica  2759 17.00% 4.10% 0.80% 78.04% NA
All Japonica  1512 58.80% 0.30% 0.66% 40.28% NA
Aus  269 8.20% 21.60% 0.00% 70.26% NA
Indica I  595 29.20% 0.20% 0.50% 70.08% NA
Indica II  465 12.30% 1.70% 0.43% 85.59% NA
Indica III  913 9.90% 5.80% 0.77% 83.57% NA
Indica Intermediate  786 19.00% 6.60% 1.27% 73.16% NA
Temperate Japonica  767 93.00% 0.00% 0.00% 7.04% NA
Tropical Japonica  504 10.70% 0.60% 0.99% 87.70% NA
Japonica Intermediate  241 50.60% 0.40% 2.07% 46.89% NA
VI/Aromatic  96 79.20% 7.30% 0.00% 13.54% NA
Intermediate  90 35.60% 11.10% 0.00% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505633755 A -> DEL N N silent_mutation Average:14.457; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633755 A -> G LOC_Os05g10310.1 upstream_gene_variant ; 849.0bp to feature; MODIFIER silent_mutation Average:14.457; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633755 A -> G LOC_Os05g10320.1 upstream_gene_variant ; 2109.0bp to feature; MODIFIER silent_mutation Average:14.457; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633755 A -> G LOC_Os05g10310.3 upstream_gene_variant ; 849.0bp to feature; MODIFIER silent_mutation Average:14.457; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633755 A -> G LOC_Os05g10310.2 upstream_gene_variant ; 849.0bp to feature; MODIFIER silent_mutation Average:14.457; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633755 A -> G LOC_Os05g10330.1 downstream_gene_variant ; 4767.0bp to feature; MODIFIER silent_mutation Average:14.457; most accessible tissue: Callus, score: 62.814 N N N N
vg0505633755 A -> G LOC_Os05g10310-LOC_Os05g10320 intergenic_region ; MODIFIER silent_mutation Average:14.457; most accessible tissue: Callus, score: 62.814 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505633755 1.39E-14 1.18E-12 mr1697 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505633755 5.70E-14 2.66E-14 mr1697 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251