Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505633755:

Variant ID: vg0505633755 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5633755
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAACCGTATTCCCTAGCTTGCACCTTTGCATCAAGGAGATAGCACTATACACTGTTGGCGCTTTTTTAGGCCAACACAAGATCACCTAACGATTTACGGT[A/G]
TAATCAACAGAGTTGCCAAAATCGTTAGATCAAAACTAGCTAGCAAAGCCGATTTCAAGATTAATTCACTTTCACGGAATCAAGCGACTAATTTACAAGC

Reverse complement sequence

GCTTGTAAATTAGTCGCTTGATTCCGTGAAAGTGAATTAATCTTGAAATCGGCTTTGCTAGCTAGTTTTGATCTAACGATTTTGGCAACTCTGTTGATTA[T/C]
ACCGTAAATCGTTAGGTGATCTTGTGTTGGCCTAAAAAAGCGCCAACAGTGTATAGTGCTATCTCCTTGATGCAAAGGTGCAAGCTAGGGAATACGGTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.50%	4.10%	0.68%	63.73%	NA
All Indica	2759	17.00%	4.10%	0.80%	78.04%	NA
All Japonica	1512	58.80%	0.30%	0.66%	40.28%	NA
Aus	269	8.20%	21.60%	0.00%	70.26%	NA
Indica I	595	29.20%	0.20%	0.50%	70.08%	NA
Indica II	465	12.30%	1.70%	0.43%	85.59%	NA
Indica III	913	9.90%	5.80%	0.77%	83.57%	NA
Indica Intermediate	786	19.00%	6.60%	1.27%	73.16%	NA
Temperate Japonica	767	93.00%	0.00%	0.00%	7.04%	NA
Tropical Japonica	504	10.70%	0.60%	0.99%	87.70%	NA
Japonica Intermediate	241	50.60%	0.40%	2.07%	46.89%	NA
VI/Aromatic	96	79.20%	7.30%	0.00%	13.54%	NA
Intermediate	90	35.60%	11.10%	0.00%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505633755	A -> DEL	N	N	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633755	A -> G	LOC_Os05g10310.1	upstream_gene_variant ; 849.0bp to feature; MODIFIER	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633755	A -> G	LOC_Os05g10320.1	upstream_gene_variant ; 2109.0bp to feature; MODIFIER	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633755	A -> G	LOC_Os05g10310.3	upstream_gene_variant ; 849.0bp to feature; MODIFIER	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633755	A -> G	LOC_Os05g10310.2	upstream_gene_variant ; 849.0bp to feature; MODIFIER	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633755	A -> G	LOC_Os05g10330.1	downstream_gene_variant ; 4767.0bp to feature; MODIFIER	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 62.814	N	N	N	N
vg0505633755	A -> G	LOC_Os05g10310-LOC_Os05g10320	intergenic_region ; MODIFIER	silent_mutation	Average:14.457; most accessible tissue: Callus, score: 62.814	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505633755	1.39E-14	1.18E-12	mr1697	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505633755	5.70E-14	2.66E-14	mr1697	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251