Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505629606:

Variant ID: vg0505629606 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5629606
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCATATAGGTGCTGGTTCTAATCTAAAGAGCCACGTGGTTATTCTAATAAGTGTCGGTTCTTTAGAATAACCGGCACCTTTTAGTATCATATAGGTGTC[A/G]
GTTATATCATTTTATATCATTTTTGACACCTATAGTGCCAATCTGAATGTCCATTTATGTAGTGGTGATATACATTCGAAATTAGTATAAAAGTTATAGG

Reverse complement sequence

CCTATAACTTTTATACTAATTTCGAATGTATATCACCACTACATAAATGGACATTCAGATTGGCACTATAGGTGTCAAAAATGATATAAAATGATATAAC[T/C]
GACACCTATATGATACTAAAAGGTGCCGGTTATTCTAAAGAACCGACACTTATTAGAATAACCACGTGGCTCTTTAGATTAGAACCAGCACCTATATGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.40%	4.00%	0.76%	63.75%	NA
All Indica	2759	17.00%	4.10%	0.91%	77.96%	NA
All Japonica	1512	58.60%	0.30%	0.60%	40.54%	NA
Aus	269	8.60%	21.60%	0.00%	69.89%	NA
Indica I	595	29.20%	0.20%	0.67%	69.92%	NA
Indica II	465	11.80%	1.50%	1.29%	85.38%	NA
Indica III	913	9.90%	5.90%	0.77%	83.46%	NA
Indica Intermediate	786	19.20%	6.50%	1.02%	73.28%	NA
Temperate Japonica	767	92.80%	0.00%	0.13%	7.04%	NA
Tropical Japonica	504	10.70%	0.60%	0.99%	87.70%	NA
Japonica Intermediate	241	49.80%	0.40%	1.24%	48.55%	NA
VI/Aromatic	96	79.20%	7.30%	0.00%	13.54%	NA
Intermediate	90	34.40%	10.00%	2.22%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505629606	A -> DEL	N	N	silent_mutation	Average:10.784; most accessible tissue: Callus, score: 47.047	N	N	N	N
vg0505629606	A -> G	LOC_Os05g10310.1	downstream_gene_variant ; 1236.0bp to feature; MODIFIER	silent_mutation	Average:10.784; most accessible tissue: Callus, score: 47.047	N	N	N	N
vg0505629606	A -> G	LOC_Os05g10310.3	intron_variant ; MODIFIER	silent_mutation	Average:10.784; most accessible tissue: Callus, score: 47.047	N	N	N	N
vg0505629606	A -> G	LOC_Os05g10310.2	intron_variant ; MODIFIER	silent_mutation	Average:10.784; most accessible tissue: Callus, score: 47.047	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505629606	6.91E-06	NA	mr1190	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606	3.38E-06	NA	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606	6.55E-06	NA	mr1245	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606	2.26E-06	NA	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606	6.53E-06	6.53E-06	mr1373	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606	2.10E-13	2.00E-11	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606	8.42E-13	7.64E-14	mr1697	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251