\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505629606:

Variant ID: vg0505629606 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5629606
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCATATAGGTGCTGGTTCTAATCTAAAGAGCCACGTGGTTATTCTAATAAGTGTCGGTTCTTTAGAATAACCGGCACCTTTTAGTATCATATAGGTGTC[A/G]
GTTATATCATTTTATATCATTTTTGACACCTATAGTGCCAATCTGAATGTCCATTTATGTAGTGGTGATATACATTCGAAATTAGTATAAAAGTTATAGG

Reverse complement sequence

CCTATAACTTTTATACTAATTTCGAATGTATATCACCACTACATAAATGGACATTCAGATTGGCACTATAGGTGTCAAAAATGATATAAAATGATATAAC[T/C]
GACACCTATATGATACTAAAAGGTGCCGGTTATTCTAAAGAACCGACACTTATTAGAATAACCACGTGGCTCTTTAGATTAGAACCAGCACCTATATGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.40% 4.00% 0.76% 63.75% NA
All Indica  2759 17.00% 4.10% 0.91% 77.96% NA
All Japonica  1512 58.60% 0.30% 0.60% 40.54% NA
Aus  269 8.60% 21.60% 0.00% 69.89% NA
Indica I  595 29.20% 0.20% 0.67% 69.92% NA
Indica II  465 11.80% 1.50% 1.29% 85.38% NA
Indica III  913 9.90% 5.90% 0.77% 83.46% NA
Indica Intermediate  786 19.20% 6.50% 1.02% 73.28% NA
Temperate Japonica  767 92.80% 0.00% 0.13% 7.04% NA
Tropical Japonica  504 10.70% 0.60% 0.99% 87.70% NA
Japonica Intermediate  241 49.80% 0.40% 1.24% 48.55% NA
VI/Aromatic  96 79.20% 7.30% 0.00% 13.54% NA
Intermediate  90 34.40% 10.00% 2.22% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505629606 A -> DEL N N silent_mutation Average:10.784; most accessible tissue: Callus, score: 47.047 N N N N
vg0505629606 A -> G LOC_Os05g10310.1 downstream_gene_variant ; 1236.0bp to feature; MODIFIER silent_mutation Average:10.784; most accessible tissue: Callus, score: 47.047 N N N N
vg0505629606 A -> G LOC_Os05g10310.3 intron_variant ; MODIFIER silent_mutation Average:10.784; most accessible tissue: Callus, score: 47.047 N N N N
vg0505629606 A -> G LOC_Os05g10310.2 intron_variant ; MODIFIER silent_mutation Average:10.784; most accessible tissue: Callus, score: 47.047 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505629606 6.91E-06 NA mr1190 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606 3.38E-06 NA mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606 6.55E-06 NA mr1245 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606 2.26E-06 NA mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606 6.53E-06 6.53E-06 mr1373 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606 2.10E-13 2.00E-11 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505629606 8.42E-13 7.64E-14 mr1697 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251