\
| Variant ID: vg0505629606 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5629606 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATCATATAGGTGCTGGTTCTAATCTAAAGAGCCACGTGGTTATTCTAATAAGTGTCGGTTCTTTAGAATAACCGGCACCTTTTAGTATCATATAGGTGTC[A/G]
GTTATATCATTTTATATCATTTTTGACACCTATAGTGCCAATCTGAATGTCCATTTATGTAGTGGTGATATACATTCGAAATTAGTATAAAAGTTATAGG
CCTATAACTTTTATACTAATTTCGAATGTATATCACCACTACATAAATGGACATTCAGATTGGCACTATAGGTGTCAAAAATGATATAAAATGATATAAC[T/C]
GACACCTATATGATACTAAAAGGTGCCGGTTATTCTAAAGAACCGACACTTATTAGAATAACCACGTGGCTCTTTAGATTAGAACCAGCACCTATATGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.40% | 4.00% | 0.76% | 63.75% | NA |
| All Indica | 2759 | 17.00% | 4.10% | 0.91% | 77.96% | NA |
| All Japonica | 1512 | 58.60% | 0.30% | 0.60% | 40.54% | NA |
| Aus | 269 | 8.60% | 21.60% | 0.00% | 69.89% | NA |
| Indica I | 595 | 29.20% | 0.20% | 0.67% | 69.92% | NA |
| Indica II | 465 | 11.80% | 1.50% | 1.29% | 85.38% | NA |
| Indica III | 913 | 9.90% | 5.90% | 0.77% | 83.46% | NA |
| Indica Intermediate | 786 | 19.20% | 6.50% | 1.02% | 73.28% | NA |
| Temperate Japonica | 767 | 92.80% | 0.00% | 0.13% | 7.04% | NA |
| Tropical Japonica | 504 | 10.70% | 0.60% | 0.99% | 87.70% | NA |
| Japonica Intermediate | 241 | 49.80% | 0.40% | 1.24% | 48.55% | NA |
| VI/Aromatic | 96 | 79.20% | 7.30% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 34.40% | 10.00% | 2.22% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505629606 | A -> DEL | N | N | silent_mutation | Average:10.784; most accessible tissue: Callus, score: 47.047 | N | N | N | N |
| vg0505629606 | A -> G | LOC_Os05g10310.1 | downstream_gene_variant ; 1236.0bp to feature; MODIFIER | silent_mutation | Average:10.784; most accessible tissue: Callus, score: 47.047 | N | N | N | N |
| vg0505629606 | A -> G | LOC_Os05g10310.3 | intron_variant ; MODIFIER | silent_mutation | Average:10.784; most accessible tissue: Callus, score: 47.047 | N | N | N | N |
| vg0505629606 | A -> G | LOC_Os05g10310.2 | intron_variant ; MODIFIER | silent_mutation | Average:10.784; most accessible tissue: Callus, score: 47.047 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505629606 | 6.91E-06 | NA | mr1190 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505629606 | 3.38E-06 | NA | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505629606 | 6.55E-06 | NA | mr1245 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505629606 | 2.26E-06 | NA | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505629606 | 6.53E-06 | 6.53E-06 | mr1373 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505629606 | 2.10E-13 | 2.00E-11 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505629606 | 8.42E-13 | 7.64E-14 | mr1697 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |