\
| Variant ID: vg0505628393 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5628393 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGAATCCGGGCGAGGACGCTGTGAGGAGGGAGGAGCGCGACGCGGCACGGCATGCGACCGAGCGAACCGACGCCGCATGCGGTCGAATGCCCCGGCTCAC[A/C]
CGTACTCCCTCGGTCAAAAAAACAAATGTAGAACAAGATGTGGTATATTGTATATCTTAGTACTACAAATCTATACATATAATATTAAAATATATCACAT
ATGTGATATATTTTAATATTATATGTATAGATTTGTAGTACTAAGATATACAATATACCACATCTTGTTCTACATTTGTTTTTTTGACCGAGGGAGTACG[T/G]
GTGAGCCGGGGCATTCGACCGCATGCGGCGTCGGTTCGCTCGGTCGCATGCCGTGCCGCGTCGCGCTCCTCCCTCCTCACAGCGTCCTCGCCCGGATTCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.70% | 3.80% | 1.59% | 62.97% | NA |
| All Indica | 2759 | 16.80% | 4.10% | 0.91% | 78.22% | NA |
| All Japonica | 1512 | 58.70% | 0.20% | 0.13% | 40.94% | NA |
| Aus | 269 | 8.90% | 21.60% | 16.36% | 53.16% | NA |
| Indica I | 595 | 29.20% | 0.20% | 0.67% | 69.92% | NA |
| Indica II | 465 | 12.30% | 1.50% | 1.51% | 84.73% | NA |
| Indica III | 913 | 9.30% | 5.90% | 0.44% | 84.34% | NA |
| Indica Intermediate | 786 | 18.80% | 6.40% | 1.27% | 73.54% | NA |
| Temperate Japonica | 767 | 92.60% | 0.00% | 0.00% | 7.43% | NA |
| Tropical Japonica | 504 | 11.10% | 0.60% | 0.20% | 88.10% | NA |
| Japonica Intermediate | 241 | 50.60% | 0.00% | 0.41% | 48.96% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 1.04% | 12.50% | NA |
| Intermediate | 90 | 41.10% | 6.70% | 3.33% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505628393 | A -> DEL | N | N | silent_mutation | Average:18.157; most accessible tissue: Callus, score: 95.865 | N | N | N | N |
| vg0505628393 | A -> C | LOC_Os05g10300.1 | upstream_gene_variant ; 4516.0bp to feature; MODIFIER | silent_mutation | Average:18.157; most accessible tissue: Callus, score: 95.865 | N | N | N | N |
| vg0505628393 | A -> C | LOC_Os05g10310.1 | downstream_gene_variant ; 2449.0bp to feature; MODIFIER | silent_mutation | Average:18.157; most accessible tissue: Callus, score: 95.865 | N | N | N | N |
| vg0505628393 | A -> C | LOC_Os05g10310.2 | downstream_gene_variant ; 256.0bp to feature; MODIFIER | silent_mutation | Average:18.157; most accessible tissue: Callus, score: 95.865 | N | N | N | N |
| vg0505628393 | A -> C | LOC_Os05g10310.3 | intron_variant ; MODIFIER | silent_mutation | Average:18.157; most accessible tissue: Callus, score: 95.865 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505628393 | 9.02E-06 | 9.02E-06 | mr1190 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505628393 | 4.63E-14 | 7.58E-13 | mr1697 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505628393 | 3.14E-12 | 1.52E-13 | mr1697 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |