\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505628393:

Variant ID: vg0505628393 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5628393
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAATCCGGGCGAGGACGCTGTGAGGAGGGAGGAGCGCGACGCGGCACGGCATGCGACCGAGCGAACCGACGCCGCATGCGGTCGAATGCCCCGGCTCAC[A/C]
CGTACTCCCTCGGTCAAAAAAACAAATGTAGAACAAGATGTGGTATATTGTATATCTTAGTACTACAAATCTATACATATAATATTAAAATATATCACAT

Reverse complement sequence

ATGTGATATATTTTAATATTATATGTATAGATTTGTAGTACTAAGATATACAATATACCACATCTTGTTCTACATTTGTTTTTTTGACCGAGGGAGTACG[T/G]
GTGAGCCGGGGCATTCGACCGCATGCGGCGTCGGTTCGCTCGGTCGCATGCCGTGCCGCGTCGCGCTCCTCCCTCCTCACAGCGTCCTCGCCCGGATTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.70% 3.80% 1.59% 62.97% NA
All Indica  2759 16.80% 4.10% 0.91% 78.22% NA
All Japonica  1512 58.70% 0.20% 0.13% 40.94% NA
Aus  269 8.90% 21.60% 16.36% 53.16% NA
Indica I  595 29.20% 0.20% 0.67% 69.92% NA
Indica II  465 12.30% 1.50% 1.51% 84.73% NA
Indica III  913 9.30% 5.90% 0.44% 84.34% NA
Indica Intermediate  786 18.80% 6.40% 1.27% 73.54% NA
Temperate Japonica  767 92.60% 0.00% 0.00% 7.43% NA
Tropical Japonica  504 11.10% 0.60% 0.20% 88.10% NA
Japonica Intermediate  241 50.60% 0.00% 0.41% 48.96% NA
VI/Aromatic  96 86.50% 0.00% 1.04% 12.50% NA
Intermediate  90 41.10% 6.70% 3.33% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505628393 A -> DEL N N silent_mutation Average:18.157; most accessible tissue: Callus, score: 95.865 N N N N
vg0505628393 A -> C LOC_Os05g10300.1 upstream_gene_variant ; 4516.0bp to feature; MODIFIER silent_mutation Average:18.157; most accessible tissue: Callus, score: 95.865 N N N N
vg0505628393 A -> C LOC_Os05g10310.1 downstream_gene_variant ; 2449.0bp to feature; MODIFIER silent_mutation Average:18.157; most accessible tissue: Callus, score: 95.865 N N N N
vg0505628393 A -> C LOC_Os05g10310.2 downstream_gene_variant ; 256.0bp to feature; MODIFIER silent_mutation Average:18.157; most accessible tissue: Callus, score: 95.865 N N N N
vg0505628393 A -> C LOC_Os05g10310.3 intron_variant ; MODIFIER silent_mutation Average:18.157; most accessible tissue: Callus, score: 95.865 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505628393 9.02E-06 9.02E-06 mr1190 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505628393 4.63E-14 7.58E-13 mr1697 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505628393 3.14E-12 1.52E-13 mr1697 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251