\
| Variant ID: vg0505613072 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5613072 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )
TGCATTTGAACGTGTGCCTTGTCACAACATCGGTTTTTCTGCTATGGTAATTGCTAGCTTTGCATGTAGAGAAACCAACCATATAAGCATAACCATTGTA[G/T]
AAGTCAAAAGCTTCATTCTCATCAGCAAAAACTTTGTTGATTGACGGCGCATGTGCACTGTTAGCTTCCTGACCACCTCTCTGAACAGCTGCTACACTTT
AAAGTGTAGCAGCTGTTCAGAGAGGTGGTCAGGAAGCTAACAGTGCACATGCGCCGTCAATCAACAAAGTTTTTGCTGATGAGAATGAAGCTTTTGACTT[C/A]
TACAATGGTTATGCTTATATGGTTGGTTTCTCTACATGCAAAGCTAGCAATTACCATAGCAGAAAAACCGATGTTGTGACAAGGCACACGTTCAAATGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 2.20% | 1.08% | 0.00% | NA |
| All Indica | 2759 | 94.50% | 3.70% | 1.81% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.00% | 1.34% | 0.00% | NA |
| Indica II | 465 | 75.90% | 18.30% | 5.81% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.00% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 2.30% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505613072 | G -> T | LOC_Os05g10270.1 | downstream_gene_variant ; 3438.0bp to feature; MODIFIER | silent_mutation | Average:17.38; most accessible tissue: Minghui63 flag leaf, score: 23.047 | N | N | N | N |
| vg0505613072 | G -> T | LOC_Os05g10270-LOC_Os05g10290 | intergenic_region ; MODIFIER | silent_mutation | Average:17.38; most accessible tissue: Minghui63 flag leaf, score: 23.047 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505613072 | NA | 1.42E-10 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505613072 | 9.40E-15 | NA | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505613072 | 2.77E-10 | 5.49E-12 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505613072 | NA | 3.28E-06 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505613072 | NA | 3.32E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505613072 | 2.46E-08 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505613072 | 8.72E-06 | 9.64E-10 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505613072 | NA | 1.79E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |