\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505554444:

Variant ID: vg0505554444 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5554444
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAAGGGGATAGTAATTTGGATTTGAACATTTATAAAAAAAACTAAAAATATTAATAAGGGTCCAAGCTTGGTACGAATTTTTATTTCTTAATTGCAGTT[A/T]
TAGAAAATTATCATTTTTGGAGCACACGTACCCATAGCCATGCTTGGCCTGGTAGGGCAGGGTGGAGAGGGCGGTCTCATCGACGTCGAACACCCAGATC

Reverse complement sequence

GATCTGGGTGTTCGACGTCGATGAGACCGCCCTCTCCACCCTGCCCTACCAGGCCAAGCATGGCTATGGGTACGTGTGCTCCAAAAATGATAATTTTCTA[T/A]
AACTGCAATTAAGAAATAAAAATTCGTACCAAGCTTGGACCCTTATTAATATTTTTAGTTTTTTTTATAAATGTTCAAATCCAAATTACTATCCCCTTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 32.20% 0.95% 0.00% NA
All Indica  2759 81.30% 17.10% 1.56% 0.00% NA
All Japonica  1512 39.90% 60.10% 0.07% 0.00% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 64.40% 31.60% 4.03% 0.00% NA
Indica II  465 91.20% 7.50% 1.29% 0.00% NA
Indica III  913 86.20% 13.70% 0.11% 0.00% NA
Indica Intermediate  786 82.70% 15.80% 1.53% 0.00% NA
Temperate Japonica  767 7.60% 92.40% 0.00% 0.00% NA
Tropical Japonica  504 88.50% 11.50% 0.00% 0.00% NA
Japonica Intermediate  241 41.10% 58.50% 0.41% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505554444 A -> T LOC_Os05g10220.1 downstream_gene_variant ; 4949.0bp to feature; MODIFIER silent_mutation Average:71.931; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg0505554444 A -> T LOC_Os05g10210.1 intron_variant ; MODIFIER silent_mutation Average:71.931; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505554444 NA 3.34E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505554444 NA 3.59E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 9.99E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 4.18E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 2.34E-10 mr1423 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 8.16E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 1.92E-15 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 7.03E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 5.42E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 7.56E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 2.34E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 1.37E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 3.61E-11 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 2.39E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 1.10E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 6.29E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 1.52E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 1.69E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 9.85E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 3.53E-21 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 1.56E-07 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 1.55E-08 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 1.04E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505554444 NA 1.25E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251