\
| Variant ID: vg0505539259 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5539259 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATAGAGGGCTGCTACAAAACGGGATCCCGTTACAACGGGATAGACATATTAACTATTTTCTTGCACGAGTATCACAGGTATCAGGTCTTAGGTATCACAG[A/G]
TACCAAGTAACAGGTATCGTAGAAATCGGGTACCATGTAGCTGGTACCATAACATGTATCATGTATAGGTACTGTCTCATAGAAGAGTATCCCGTTCCAA
TTGGAACGGGATACTCTTCTATGAGACAGTACCTATACATGATACATGTTATGGTACCAGCTACATGGTACCCGATTTCTACGATACCTGTTACTTGGTA[T/C]
CTGTGATACCTAAGACCTGATACCTGTGATACTCGTGCAAGAAAATAGTTAATATGTCTATCCCGTTGTAACGGGATCCCGTTTTGTAGCAGCCCTCTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.60% | 27.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 46.30% | 53.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 15.20% | 84.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 70.40% | 29.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.10% | 87.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505539259 | A -> G | LOC_Os05g09740.1 | upstream_gene_variant ; 3149.0bp to feature; MODIFIER | silent_mutation | Average:64.704; most accessible tissue: Callus, score: 83.682 | N | N | N | N |
| vg0505539259 | A -> G | LOC_Os05g09740-LOC_Os05g10210 | intergenic_region ; MODIFIER | silent_mutation | Average:64.704; most accessible tissue: Callus, score: 83.682 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505539259 | NA | 3.51E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 1.67E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | 4.19E-06 | NA | mr1697 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | 9.29E-09 | 8.52E-10 | mr1697 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 5.19E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 1.31E-07 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 1.31E-07 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 2.31E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 1.40E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 7.61E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 8.98E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 2.25E-08 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 7.04E-08 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 5.48E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505539259 | NA | 2.24E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |