\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505530975:

Variant ID: vg0505530975 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5530975
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTCCCCGCGTCGCCCGCCGCCGCCGTGTCCTCCCCTACCGCCGCGTCCACCTCCTCGGCGCCGCCCGCCACGTAGACCAAAACCACCGTGGATTGGGT[C/T]
AGGGGGGTAATTTGTCCGGTTTATATAGTTTAGGGTGAAGAATGCCCGGTTTTATGTGGTTCAGGGGGGTAATTCAGACGACCGCGATAGTTCGGGGGTG

Reverse complement sequence

CACCCCCGAACTATCGCGGTCGTCTGAATTACCCCCCTGAACCACATAAAACCGGGCATTCTTCACCCTAAACTATATAAACCGGACAAATTACCCCCCT[G/A]
ACCCAATCCACGGTGGTTTTGGTCTACGTGGCGGGCGGCGCCGAGGAGGTGGACGCGGCGGTAGGGGAGGACACGGCGGCGGCGGGCGACGCGGGGAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 2.20% 0.17% 13.52% NA
All Indica  2759 94.50% 3.70% 0.22% 1.67% NA
All Japonica  1512 62.20% 0.00% 0.13% 37.63% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 94.20% 2.60% 0.00% 3.23% NA
Indica III  913 92.90% 5.50% 0.66% 0.99% NA
Indica Intermediate  786 92.60% 4.60% 0.00% 2.80% NA
Temperate Japonica  767 94.30% 0.00% 0.00% 5.74% NA
Tropical Japonica  504 13.50% 0.00% 0.40% 86.11% NA
Japonica Intermediate  241 62.20% 0.00% 0.00% 37.76% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 73.30% 1.10% 0.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505530975 C -> T LOC_Os05g09736.1 upstream_gene_variant ; 4625.0bp to feature; MODIFIER silent_mutation Average:62.93; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0505530975 C -> T LOC_Os05g09740.1 downstream_gene_variant ; 3553.0bp to feature; MODIFIER silent_mutation Average:62.93; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0505530975 C -> T LOC_Os05g09736-LOC_Os05g09740 intergenic_region ; MODIFIER silent_mutation Average:62.93; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0505530975 C -> DEL N N silent_mutation Average:62.93; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505530975 2.43E-06 2.43E-06 mr1190 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505530975 2.89E-07 1.19E-06 mr1245 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505530975 3.97E-07 3.97E-07 mr1373 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505530975 5.14E-06 5.14E-06 mr1652 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505530975 4.88E-14 2.81E-15 mr1697 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251