Variant ID: vg0505530975 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 5530975 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCTCCCCGCGTCGCCCGCCGCCGCCGTGTCCTCCCCTACCGCCGCGTCCACCTCCTCGGCGCCGCCCGCCACGTAGACCAAAACCACCGTGGATTGGGT[C/T]
AGGGGGGTAATTTGTCCGGTTTATATAGTTTAGGGTGAAGAATGCCCGGTTTTATGTGGTTCAGGGGGGTAATTCAGACGACCGCGATAGTTCGGGGGTG
CACCCCCGAACTATCGCGGTCGTCTGAATTACCCCCCTGAACCACATAAAACCGGGCATTCTTCACCCTAAACTATATAAACCGGACAAATTACCCCCCT[G/A]
ACCCAATCCACGGTGGTTTTGGTCTACGTGGCGGGCGGCGCCGAGGAGGTGGACGCGGCGGTAGGGGAGGACACGGCGGCGGCGGGCGACGCGGGGAGGA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 84.10% | 2.20% | 0.17% | 13.52% | NA |
All Indica | 2759 | 94.50% | 3.70% | 0.22% | 1.67% | NA |
All Japonica | 1512 | 62.20% | 0.00% | 0.13% | 37.63% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica II | 465 | 94.20% | 2.60% | 0.00% | 3.23% | NA |
Indica III | 913 | 92.90% | 5.50% | 0.66% | 0.99% | NA |
Indica Intermediate | 786 | 92.60% | 4.60% | 0.00% | 2.80% | NA |
Temperate Japonica | 767 | 94.30% | 0.00% | 0.00% | 5.74% | NA |
Tropical Japonica | 504 | 13.50% | 0.00% | 0.40% | 86.11% | NA |
Japonica Intermediate | 241 | 62.20% | 0.00% | 0.00% | 37.76% | NA |
VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
Intermediate | 90 | 73.30% | 1.10% | 0.00% | 25.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0505530975 | C -> T | LOC_Os05g09736.1 | upstream_gene_variant ; 4625.0bp to feature; MODIFIER | silent_mutation | Average:62.93; most accessible tissue: Zhenshan97 young leaf, score: 79.225 | N | N | N | N |
vg0505530975 | C -> T | LOC_Os05g09740.1 | downstream_gene_variant ; 3553.0bp to feature; MODIFIER | silent_mutation | Average:62.93; most accessible tissue: Zhenshan97 young leaf, score: 79.225 | N | N | N | N |
vg0505530975 | C -> T | LOC_Os05g09736-LOC_Os05g09740 | intergenic_region ; MODIFIER | silent_mutation | Average:62.93; most accessible tissue: Zhenshan97 young leaf, score: 79.225 | N | N | N | N |
vg0505530975 | C -> DEL | N | N | silent_mutation | Average:62.93; most accessible tissue: Zhenshan97 young leaf, score: 79.225 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0505530975 | 2.43E-06 | 2.43E-06 | mr1190 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505530975 | 2.89E-07 | 1.19E-06 | mr1245 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505530975 | 3.97E-07 | 3.97E-07 | mr1373 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505530975 | 5.14E-06 | 5.14E-06 | mr1652 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505530975 | 4.88E-14 | 2.81E-15 | mr1697 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |